Morpholino

MO1-a2ml

ID

ZDB-MRPHLNO-090212-1

Name

MO1-a2ml

Previous Names

ATG MO (1)

Targets

a2ml (1)
a2ml3 (1)

Sequence

5' - ACAACAGCTAACATTCAGAGCCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino targets a2ml and the related neighboring gene sb:cb37, both located in a cluster of a2m-like genes on LG15.

Genome Resources

None

Target Location

View all 4 target locations

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-a2ml

Expressed Gene	Anatomy	Figures
cp	liver liver primordium	Fig. 2 , text only from Hong et al., 2008
fabp2	gut	Fig. 4 from Hong et al., 2008
fabp10a	liver	Fig. 4 from Hong et al., 2008
foxa3	liver pancreas	Fig. 2 from Hong et al., 2008
hhex	heart liver liver primordium pancreas pancreas primordium	Fig. 2 , text only from Hong et al., 2008
ins	endocrine pancreas	Fig. 4 from Hong et al., 2008
tfa	liver	Fig. 2 , Fig. 4 from Hong et al., 2008

Phenotype

Phenotype resulting from MO1-a2ml

No data available

Phenotype of all Fish created by or utilizing MO1-a2ml

Phenotype	Fish	Conditions	Figures
liver decreased size, abnormal	s854Tg/+ + MO1-a2ml (AB)	standard conditions	Fig. 3 from Hong et al., 2008
liver development disrupted, abnormal	s854Tg/+ + MO1-a2ml (AB)	standard conditions	Fig. 3 from Hong et al., 2008
yolk increased size, abnormal	s854Tg/+ + MO1-a2ml (AB)	standard conditions	Fig. 3 from Hong et al., 2008
swim bladder inflation disrupted, abnormal	s854Tg/+ + MO1-a2ml (AB)	standard conditions	Fig. 3 from Hong et al., 2008
liver vacuolated, abnormal	WT + MO1-a2ml	standard conditions	Fig. 5 from Hong et al., 2008
liver decreased size, abnormal	WT + MO1-a2ml	standard conditions	Fig. 4 , Fig. 5 , text only from Hong et al., 2008
yolk increased size, abnormal	WT + MO1-a2ml	standard conditions	Fig. 5 from Hong et al., 2008
cell differentiation disrupted, abnormal	WT + MO1-a2ml	standard conditions	Fig. 5 from Hong et al., 2008
hepatocyte decreased amount, abnormal	WT + MO1-a2ml	standard conditions	Fig. 5 , Fig. 6 from Hong et al., 2008
swim bladder inflation disrupted, abnormal	WT + MO1-a2ml	standard conditions	Fig. 5 from Hong et al., 2008
gut decreased size, abnormal	WT + MO1-a2ml	standard conditions	Fig. 4 from Hong et al., 2008
lipid metabolic process disrupted, abnormal	WT + MO1-a2ml	standard conditions	Fig. 5 from Hong et al., 2008
liver morphology, abnormal	WT + MO1-a2ml	standard conditions	Fig. 2 from Hong et al., 2008
digestive tract development disrupted, abnormal	WT + MO1-a2ml	standard conditions	Fig. 4 from Hong et al., 2008
liver development disrupted, abnormal	WT + MO1-a2ml	standard conditions	Fig. 2 , Fig. 4 , Fig. 5 , text only from Hong et al., 2008
cell population proliferation disrupted, abnormal	WT + MO1-a2ml	standard conditions	Fig. 6 from Hong et al., 2008

Citations