Morpholino

MO1-met

ID
ZDB-MRPHLNO-071219-1
Name
MO1-met
Previous Names
  • CM1 (1)
  • CM1a (1)
  • c-met AUG MO (1)
Target
Sequence
5' - ATAGTGAATTGTCATCTTTGTTCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-met
Expressed Gene Anatomy Figures
alcama Fig. 4 with image from Anderson et al., 2013
cp Fig. 4 with image from Latimer et al., 2008
foxa3 Fig. 2 with image,  Fig. 4 with image from Latimer et al., 2008
hhex Fig. 4 with image from Latimer et al., 2008
myod1 Fig. 2 with image from Latimer et al., 2008
pax2a Fig. 4 with image from Latimer et al., 2008
prox1a Fig. 4 with image from Anderson et al., 2013
Phenotype
Phenotype resulting from MO1-met
Phenotype Fish Figures
exocrine pancreas development disrupted, abnormal ia3Tg + MO1-met Fig. 4 with image from Anderson et al., 2013
liver decreased size, abnormal AB + MO1-met Fig. 4 with image from Latimer et al., 2008
liver development disrupted, abnormal AB + MO1-met Fig. 4 with image from Latimer et al., 2008
pancreas spheroid, abnormal gz15Tg; jh1Tg; m1018Tg + MO1-met Fig. 1 with image,  Fig. 4 with image from Anderson et al., 2013
pancreatic duct morphology, abnormal jh1Tg; m1018Tg + MO1-met Fig. 4 with image from Anderson et al., 2013
pancreatic duct cell migration disrupted, abnormal jh1Tg; m1018Tg + MO1-met Fig. 4 with image from Anderson et al., 2013
pancreatic ductal cell located in hepatic duct, abnormal jh1Tg; m1018Tg + MO1-met Fig. 4 with image from Anderson et al., 2013
pectoral fin morphology, abnormal AB + MO1-met Fig. 2 with image from Latimer et al., 2008
pectoral fin musculature decreased tonicity, abnormal ia3Tg + MO1-met Fig. 4 with image from Anderson et al., 2013
whole organism curved ventral, abnormal AB + MO1-met Fig. 4 with image from Latimer et al., 2008
Phenotype of all Fish created by or utilizing MO1-met
Phenotype Fish Conditions Figures
liver development disrupted, abnormal AB + MO1-met standard conditions Fig. 4 with image from Latimer et al., 2008
liver decreased size, abnormal AB + MO1-met standard conditions Fig. 4 with image from Latimer et al., 2008
whole organism curved ventral, abnormal AB + MO1-met standard conditions Fig. 4 with image from Latimer et al., 2008
pectoral fin morphology, abnormal AB + MO1-met standard conditions Fig. 2 with image from Latimer et al., 2008
musculoskeletal movement, spinal reflex action decreased rate, abnormal WT + MO1-met + MO2-met standard conditions Fig. 3 with image from Tallafuss et al., 2008
CaP motoneuron neurotransmitter mislocalised, abnormal WT + MO1-met + MO2-met standard conditions Fig. 8 with image from Tallafuss et al., 2008
motor neuron axon decreased length, abnormal WT + MO1-met + MO2-met standard conditions Fig. 5 with image from Tallafuss et al., 2008
cerebellum apoptotic process increased occurrence, abnormal WT + MO1-met + MO2-met standard conditions Fig. 9 with image from Tsai et al., 2015
CaP motoneuron obsolete cellular biosynthetic process disrupted, abnormal WT + MO1-met + MO2-met standard conditions Fig. 8 with image from Tallafuss et al., 2008
CaP motoneuron axon decreased length, abnormal WT + MO1-met + MO2-met standard conditions Fig. 4 with image,  Fig. 5 with image from Tallafuss et al., 2008
cerebellum morphogenesis disrupted, abnormal WT + MO1-met + MO6-met standard conditions Fig. 3 with image from Elsen et al., 2009
cerebellum cerebellar granule cell decreased amount, abnormal WT + MO1-met + MO6-met standard conditions Fig. 4 with image from Elsen et al., 2009
central nervous system neuron differentiation disrupted, abnormal WT + MO1-met + MO6-met standard conditions Fig. 3 with image from Elsen et al., 2009
cell proliferation in midbrain decreased rate, abnormal WT + MO1-met + MO6-met standard conditions Fig. 5 with image from Elsen et al., 2009
cell proliferation in hindbrain decreased rate, abnormal WT + MO1-met + MO6-met standard conditions Fig. 5 with image from Elsen et al., 2009
cerebellum development disrupted, abnormal WT + MO1-met + MO6-met standard conditions Fig. 3 with image from Elsen et al., 2009
cerebellar granule cell differentiation disrupted, abnormal WT + MO1-met + MO6-met standard conditions Fig. 4 with image from Elsen et al., 2009
pancreas spheroid, abnormal ia3Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
pectoral fin musculature decreased tonicity, abnormal ia3Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
pancreatic duct morphology, abnormal ia3Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
exocrine pancreas development disrupted, abnormal ia3Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
pancreatic duct cell migration disrupted, abnormal ia3Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
pancreatic ductal cell located in hepatic duct, abnormal ia3Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
cerebellum development disrupted, abnormal knu3Tg + MO1-met + MO6-met standard conditions Fig. 2 with image from Elsen et al., 2009
cerebellum morphogenesis disrupted, abnormal knu3Tg + MO1-met + MO6-met standard conditions Fig. 2 with image from Elsen et al., 2009
cerebellum neuron decreased amount, abnormal knu3Tg + MO1-met + MO6-met standard conditions Fig. 2 with image from Elsen et al., 2009
central nervous system neuron differentiation disrupted, abnormal knu3Tg + MO1-met + MO6-met standard conditions Fig. 2 with image from Elsen et al., 2009
neuron migration disrupted, abnormal rw0Tg + MO1-met + MO6-met standard conditions Fig. 7 with image from Elsen et al., 2009
floor plate secondary motor neuron decreased amount, abnormal zf35Tg + MO1-met + MO2-met standard conditions Fig. 6 with image from Tallafuss et al., 2008
pancreas spheroid, abnormal gz15Tg; jh1Tg; m1018Tg + MO1-met standard conditions Fig. 1 with image from Anderson et al., 2013
pancreatic duct cell migration disrupted, abnormal jh1Tg; m1018Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
pancreatic duct morphology, abnormal jh1Tg; m1018Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
pancreatic ductal cell located in hepatic duct, abnormal jh1Tg; m1018Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
pancreas spheroid, abnormal jh1Tg; m1018Tg + MO1-met standard conditions Fig. 4 with image from Anderson et al., 2013
CaP motoneuron axon misrouted, abnormal pargamn2Et + MO1-met + MO2-met standard conditions Fig. 9 with image from Tallafuss et al., 2008
CaP motoneuron axon increased amount, abnormal pargamn2Et + MO1-met + MO2-met standard conditions Fig. 9 with image from Tallafuss et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.