Morpholino
MO1-smarcd3b
- ID
- ZDB-MRPHLNO-070409-1
- Name
- MO1-smarcd3b
- Previous Names
-
- MO1-smarcd3l
- Target
- Sequence
-
5' - TTCCCTCCGCTTCTCCTGCCTTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smarcd3b
Expressed Gene | Anatomy | Figures |
---|---|---|
lft1 |
Fig. 4 ![]() |
|
lft2 |
Fig. 4 ![]() |
|
myl7 |
Fig. 1 ![]() |
|
nkx2.5 |
Fig. 1 ![]() |
|
spaw |
text only
from Takeuchi et al., 2007 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-smarcd3b
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-smarcd3b
1 - 5 of 24 Show all
Citations
- Lou, X., Deshwar, A.R., Crump, J.G., and Scott, I.C. (2011) Smarcd3b and Gata5 promote a cardiac progenitor fate in the zebrafish embryo. Development (Cambridge, England). 138(15):3113-23
- Ochi, H., Hans, S., and Westerfield, M. (2008) Smarcd3 regulates the timing of zebrafish myogenesis onset. The Journal of biological chemistry. 283(6):3529-3536
- Takeuchi, J.K., Lickert, H., Bisgrove, B.W., Sun, X., Yamamoto, M., Chawengsaksophak, K., Hamada, H., Yost, H.J., Rossant, J., and Bruneau, B.G. (2007) Baf60c is a nuclear Notch signaling component required for the establishment of left-right asymmetry. Proceedings of the National Academy of Sciences of the United States of America. 104(3):846-851
1 - 3 of 3
Show