Morpholino

MO6-pkd2

ID
ZDB-MRPHLNO-070129-3
Name
MO6-pkd2
Previous Names
  • pkd2 MOex5
Target
Sequence
5' - GATCAACCCGTTACCTGACAATACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-pkd2
Expressed Gene Anatomy Figures
dand5 Fig. S8 with image from Hofherr et al., 2018
foxa3 Fig. 6 from Fu et al., 2008
ins Fig. 6 from Fu et al., 2008
lft2 Fig. S8 with image from Hofherr et al., 2018
myl7 Fig. 6 from Fu et al., 2008
pkd2 Fig. 8 from Obara et al., 2006
spaw Fig. S8 with image from Hofherr et al., 2018
Phenotype
Phenotype resulting from MO6-pkd2
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO6-pkd2 Fig. 4,  Fig. 5 from Fu et al., 2008
determination of left/right symmetry disrupted, abnormal hsc5Tg + MO6-pkd2 Fig. S8 with image from Hofherr et al., 2018
Fig. 6 from Fu et al., 2008
digestive system morphology, abnormal WT + MO6-pkd2 Fig. 6 from Fu et al., 2008
head lft2 expression spatial pattern, abnormal hsc5Tg + MO6-pkd2 Fig. S8 with image from Hofherr et al., 2018
heart morphology, abnormal WT + MO6-pkd2 Fig. 6 from Fu et al., 2008
heart looping disrupted, abnormal WT + MO6-pkd2 Fig. 6 from Fu et al., 2008
Kupffer's vesicle dand5 expression spatial pattern, abnormal hsc5Tg + MO6-pkd2 Fig. S8 with image from Hofherr et al., 2018
mesoderm spaw expression mislocalised, abnormal hsc5Tg + MO6-pkd2 Fig. S8 with image from Hofherr et al., 2018
pronephric glomerulus decreased thickness, abnormal WT + MO6-pkd2 Fig. 4 from Fu et al., 2008
pronephric tubule dilated, abnormal WT + MO6-pkd2 Fig. 4 from Fu et al., 2008
pronephros cystic, abnormal WT + MO6-pkd2 Fig. 4,  Fig. 5 from Fu et al., 2008
whole organism curved dorsal, abnormal WT + MO6-pkd2 Fig. 4,  Fig. 5 from Fu et al., 2008
Phenotype of all Fish created by or utilizing MO6-pkd2
Phenotype Fish Conditions Figures
pronephric glomerulus decreased thickness, abnormal WT + MO6-pkd2 standard conditions Fig. 4 from Fu et al., 2008
heart morphology, abnormal WT + MO6-pkd2 standard conditions Fig. 6 from Fu et al., 2008
heart looping disrupted, abnormal WT + MO6-pkd2 standard conditions Fig. 6 from Fu et al., 2008
determination of left/right symmetry disrupted, abnormal WT + MO6-pkd2 standard conditions Fig. 6 from Fu et al., 2008
pronephros cystic, abnormal WT + MO6-pkd2 standard conditions Fig. 4,  Fig. 5 from Fu et al., 2008
brain hydrocephalic, abnormal WT + MO6-pkd2 standard conditions Fig. 4,  Fig. 5 from Fu et al., 2008
digestive system morphology, abnormal WT + MO6-pkd2 standard conditions Fig. 6 from Fu et al., 2008
pronephric tubule dilated, abnormal WT + MO6-pkd2 standard conditions Fig. 4 from Fu et al., 2008
whole organism curved dorsal, abnormal WT + MO6-pkd2 standard conditions Fig. 4,  Fig. 5 from Fu et al., 2008
head lft2 expression spatial pattern, abnormal hsc5Tg + MO6-pkd2 standard conditions Fig. S8 with image from Hofherr et al., 2018
determination of left/right symmetry disrupted, abnormal hsc5Tg + MO6-pkd2 standard conditions Fig. S8 with image from Hofherr et al., 2018
Kupffer's vesicle dand5 expression spatial pattern, abnormal hsc5Tg + MO6-pkd2 standard conditions Fig. S8 with image from Hofherr et al., 2018
mesoderm spaw expression mislocalised, abnormal hsc5Tg + MO6-pkd2 standard conditions Fig. S8 with image from Hofherr et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.