Morpholino

MO1-smc3

ID
ZDB-MRPHLNO-070109-1
Name
MO1-smc3
Previous Names
None
Target
Sequence
5' - GTACATGGCGGTTTATGCACAAAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smc3
Phenotype
Phenotype resulting from MO1-smc3
Phenotype Fish Figures
brain necrotic, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
caudal fin aplastic, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
cell death increased occurrence, abnormal AB + MO1-smc3 Fig. 4 with image from Ghiselli, 2006
cerebellum necrotic, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
cranial cartilage cartilage development disrupted, abnormal WT + MO1-smc3 Fig. 5 from Xu et al., 2015
eye decreased size, abnormal WT + MO1-smc3 Fig. 1 from Xu et al., 2015
eye necrotic, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
head decreased size, abnormal WT + MO1-smc3 Fig. 1 from Xu et al., 2015
head apoptotic process increased occurrence, abnormal WT + MO1-smc3 Fig. 6 from Xu et al., 2015
heart edematous, abnormal WT + MO1-smc3 Fig. 1 from Xu et al., 2015
notochord morphology, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
post-vent region curved, abnormal WT + MO1-smc3 Fig. 1 from Xu et al., 2015
post-vent region morphology, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
post-vent region apoptotic process increased occurrence, abnormal WT + MO1-smc3 Fig. 6 from Xu et al., 2015
rRNA transcription decreased process quality, abnormal WT + MO1-smc3 Fig. 4 from Xu et al., 2015
somite structure, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
translation decreased process quality, abnormal WT + MO1-smc3 Fig. 3Fig. 4 from Xu et al., 2015
whole organism decreased length, abnormal AB + MO1-smc3 Fig. 1 from Xu et al., 2015
Fig. 3 with image from Ghiselli, 2006
whole organism deformed, abnormal AB + MO1-smc3 Fig. 8 with image from Muto et al., 2011
whole organism tp53 expression increased amount, abnormal WT + MO1-smc3 Fig. 1 from Xu et al., 2015
whole organism lethal (sensu genetics), abnormal WT + MO1-smc3 Fig. S4 from Xu et al., 2015
whole organism morphology, abnormal AB + MO1-smc3 Fig. 3 with image from Ghiselli, 2006
whole organism ploidy, abnormal AB + MO1-smc3 Fig. 7 with image from Ghiselli, 2006
Phenotype of all Fish created by or utilizing MO1-smc3
Phenotype Fish Conditions Figures
whole organism morphology, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
caudal fin aplastic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
whole organism decreased length, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
post-vent region morphology, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
whole organism deformed, abnormal AB + MO1-smc3 standard conditions Fig. 8 with image from Muto et al., 2011
notochord morphology, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
cell death increased occurrence, abnormal AB + MO1-smc3 standard conditions Fig. 4 with image from Ghiselli, 2006
whole organism ploidy, abnormal AB + MO1-smc3 standard conditions Fig. 7 with image from Ghiselli, 2006
brain necrotic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
somite structure, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
cerebellum necrotic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
eye necrotic, abnormal AB + MO1-smc3 standard conditions Fig. 3 with image from Ghiselli, 2006
eye decreased size, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
cranial cartilage cartilage development disrupted, abnormal WT + MO1-smc3 standard conditions Fig. 5 from Xu et al., 2015
post-vent region curved, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
rRNA transcription decreased process quality, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 4 from Xu et al., 2015
translation decreased process quality, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 3Fig. 4 from Xu et al., 2015
cranial cartilage cartilage development decreased process quality, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 5 from Xu et al., 2015
post-vent region curved, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
heart edematous, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
post-vent region apoptotic process increased occurrence, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 6 from Xu et al., 2015
whole organism lethal (sensu genetics), ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. S4 from Xu et al., 2015
head decreased size, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
whole organism tp53 expression increased amount, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
whole organism decreased length, abnormal WT + MO1-smc3 standard conditions Fig. 1 from Xu et al., 2015
head apoptotic process increased occurrence, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 6 from Xu et al., 2015
head apoptotic process increased occurrence, abnormal WT + MO1-smc3 standard conditions Fig. 6 from Xu et al., 2015
whole organism lethal (sensu genetics), abnormal WT + MO1-smc3 standard conditions Fig. S4 from Xu et al., 2015
rRNA transcription decreased process quality, abnormal WT + MO1-smc3 standard conditions Fig. 4 from Xu et al., 2015
trunk decreased length, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
eye decreased size, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
translation decreased process quality, abnormal WT + MO1-smc3 standard conditions Fig. 3Fig. 4 from Xu et al., 2015
head decreased size, ameliorated WT + MO1-smc3 chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
post-vent region apoptotic process increased occurrence, abnormal WT + MO1-smc3 standard conditions Fig. 6 from Xu et al., 2015
Citations