Morpholino
MO1-hey2
- ID
- ZDB-MRPHLNO-060928-3
- Name
- MO1-hey2
- Previous Names
-
- grlMO (1)
- Target
- Sequence
-
5' - CGCGCAGGTACAGACACCAAAAACT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hey2
Expressed Gene | Anatomy | Figures |
---|---|---|
efnb2a |
Fig. 1
from Esser et al., 2018 |
|
ephb2a |
|
Fig. 3 ![]() |
ephb4a |
Fig. 2
from Esser et al., 2018 |
|
flt4 |
Fig. 3 ![]() |
|
hsd3b |
Fig. 7 ![]() |
1 - 5 of 6 Show all
Phenotype
Phenotype resulting from MO1-hey2
1 - 5 of 18 Show all
Phenotype of all Fish created by or utilizing MO1-hey2
1 - 5 of 20 Show all
Citations
- Esser, J.S., Steiner, R.E., Deckler, M., Schmitt, H., Engert, B., Link, S., Charlet, A., Patterson, C., Bode, C., Zhou, Q., Moser, M. (2018) Extracellular bone morphogenetic protein modulator BMPER and twisted gastrulation homolog 1 preserve arterial venous specification in zebrafish blood vessel development and regulate Notch signaling in endothelial cells. The FEBS journal. 285(8):1419-1436
- Gibb, N., Lazic, S., Yuan, X., Deshwar, A.R., Leslie, M., Wilson, M.D., Scott, I.C. (2018) Hey2 regulates the size of the cardiac progenitor pool during vertebrate heart development. Development (Cambridge, England). 145(22):
- Karthik, S., Djukic, T., Kim, J.D., Zuber, B., Makanya, A., Odriozola, A., Hlushchuk, R., Filipovic, N., Jin, S.W., Djonov, V. (2018) Synergistic interaction of sprouting and intussusceptive angiogenesis during zebrafish caudal vein plexus development. Scientific Reports. 8:9840
- Chen, X., Gays, D., Milia, C., Santoro, M.M. (2017) Cilia Control Vascular Mural Cell Recruitment in Vertebrates. Cell Reports. 18:1033-1047
- Hermkens, D.M., van Impel, A., Urasaki, A., Bussmann, J., Duckers, H.J., Schulte-Merker, S. (2015) Sox7 controls arterial specification in conjunction with hey2 and efnb2 function. Development (Cambridge, England). 142(9):1695-704
- Chun, C.Z., Remadevi, I., Schupp, M.O., Samant, G.V., Pramanik, K., Wilkinson, G.A., and Ramchandran, R. (2011) Fli+ etsrp+ Hemato-Vascular Progenitor Cells Proliferate at the Lateral Plate Mesoderm during Vasculogenesis in Zebrafish. PLoS One. 6(2):e14732
- Chou, C.W., Hsu, H.C., Quek, S.I., Chan, W.K., and Liu, Y.W. (2010) Arterial and venous vessels are required for modulating developmental relocalization and laterality of the interrenal tissue in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(7):1995-2004
- Rowlinson, J.M., and Gering, M. (2010) Hey2 acts upstream of Notch in hematopoietic stem cell specification in zebrafish embryos. Blood. 116(12):2046-2056
- Herbert, S.P., Huisken, J., Kim, T.N., Feldman, M.E., Houseman, B.T., Wang, R.A., Shokat, K.M., and Stainier, D.Y. (2009) Arterial-venous segregation by selective cell sprouting: an alternative mode of blood vessel formation. Science (New York, N.Y.). 326(5950):294-298
- Liu, Y.W., and Guo, L. (2006) Endothelium is required for the promotion of interrenal morphogenetic movement during early zebrafish development. Developmental Biology. 297(1):44-58
1 - 10 of 11
Show