Morpholino

MO3-tfap2a

ID

ZDB-MRPHLNO-060927-3

Name

MO3-tfap2a

Previous Names

tfap2a1 5.1mo (1)

Target

tfap2a (1)

Sequence

5' - CCTCCATTCTTAGATTTGGCCCTAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to intron 5 splice acceptor junction

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-tfap2a

Expressed Gene	Anatomy	Figures
cdh5	vascular endothelium	Fig. 6 from Damm et al., 2017
dlx2a	forebrain pharyngeal arch	Fig. 4 from Hoffman et al., 2007
efnb2a	dorsal aorta	Fig. 6 from Damm et al., 2017
foxd3	neural crest tail bud	Fig. 4 from Hoffman et al., 2007
gata1a	erythroid progenitor cell	Fig. 6 from Damm et al., 2017
gata2b	hematopoietic system	Fig. 6 from Damm et al., 2017
notch1b	dorsal aorta	Fig. 6 from Damm et al., 2017
tal1	hematopoietic multipotent progenitor cell	Fig. 6 from Damm et al., 2017
th	anterior catecholaminergic tract diencephalon endohypothalamic tract medial longitudinal catecholaminergic tract	Fig. 4, Fig. 7, Fig. 8 from Kastenhuber et al., 2010

Phenotype

Phenotype resulting from MO3-tfap2a

Phenotype	Fish	Figures
anterior catecholaminergic tract decreased size, abnormal	WT + MO3-tfap2a	Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal	WT + MO3-tfap2a	Fig. 4 from Kastenhuber et al., 2010
mandibular arch skeleton malformed, abnormal	ir937Tg + MO3-tfap2a	Fig. 5 from Hoffman et al., 2007
medulla oblongata adrenergic neuron absent, abnormal	WT + MO3-tfap2a	Fig. 4 from Kastenhuber et al., 2010

Phenotype of all Fish created by or utilizing MO3-tfap2a

Phenotype	Fish	Conditions	Figures
medulla oblongata adrenergic neuron absent, abnormal	WT + MO3-tfap2a	standard conditions	Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal	WT + MO3-tfap2a	standard conditions	Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal	WT + MO3-tfap2a	standard conditions	Fig. 4 from Kastenhuber et al., 2010
mandibular arch skeleton malformed, abnormal	ir937Tg + MO3-tfap2a	standard conditions	Fig. 5 from Hoffman et al., 2007
whole organism lacks all parts of type neural crest cell, abnormal	WT + MO1-tfap2c + MO3-tfap2a	standard conditions	Fig. S3 from Zhou et al., 2011
medulla oblongata adrenergic neuron absent, abnormal	otpa^m866/+ + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract decreased size, abnormal	otpa^m866/+ + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal	otpa^m866/+ + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
anterior catecholaminergic tract absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4, Fig. 7 from Kastenhuber et al., 2010
preopticohypothalamic tract absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
medial longitudinal catecholaminergic tract absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4, Fig. 8 from Kastenhuber et al., 2010
diencephalon dopaminergic neuron decreased amount, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
locus coeruleus adrenergic neuron absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
medulla oblongata adrenergic neuron absent, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
postoptic commissure decreased size, abnormal	otpa^m866/m866 + MO3-otpb + MO3-tfap2a (AB/TL)	standard conditions	Fig. 4 from Kastenhuber et al., 2010
neural crest cell decreased amount, abnormal	ir937Tg + MO1-tfap2c + MO3-tfap2a	standard conditions	Fig. 5 from Hoffman et al., 2007
mandibular arch skeleton aplastic, abnormal	ir937Tg + MO1-tfap2c + MO3-tfap2a	standard conditions	Fig. 5 from Hoffman et al., 2007
hematopoietic stem cell decreased amount, abnormal	s896Tg; zf169Tg + MO3-tfap2a	control	Fig. 5 from Damm et al., 2017

Citations