Morpholino

MO2-spaw

ID

ZDB-MRPHLNO-060112-2

Name

MO2-spaw

Previous Names

None

Target

spaw (1)

Sequence

5' - TGGTAGAGCTTCAACAGACTCTGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The authors indicate that this MO binds the last intron-exon boundary. In addition, this sequence also appears to be complementary to a portion of the mRNA containing both exons (AY24007).

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-spaw

Expressed Gene	Anatomy	Figures
kctd12.1	habenula	Fig. 2 from Kuan et al., 2007 Fig. S3 from Gamse et al., 2005
noto	epiphysis	Fig. 7 from Long et al., 2003
nrp1a	habenula	Fig. 2 from Kuan et al., 2007
otx5	parapineal organ	Fig. 2 from Kuan et al., 2007
prrx1a	lateral plate mesoderm	Fig. 4 from Ocaña et al., 2017

Phenotype

Phenotype resulting from MO2-spaw

Phenotype	Fish	Figures
determination of left/right symmetry disrupted, abnormal	zf15Tg + MO2-spaw	Fig. 2 from Kuan et al., 2007 Fig. S3 from Gamse et al., 2005
determination of pancreatic left/right asymmetry disrupted, abnormal	WT + MO2-spaw	Fig. S3 from Gamse et al., 2005
fasciculus retroflexus axon misrouted, abnormal	zf15Tg + MO2-spaw	Fig. 2 from Kuan et al., 2007
habenula symmetry, abnormal	WT + MO2-spaw	Fig. S3 from Gamse et al., 2005
heart morphogenesis process quality, abnormal	twu34Tg + MO2-spaw	Fig. 2 from Rohr et al., 2008
heart rudiment bilateral symmetry, abnormal	twu34Tg + MO2-spaw	Fig. 2 from Rohr et al., 2008
lateral plate mesoderm prrx1a expression spatial pattern, abnormal	AB + MO2-spaw	Fig. 4 from Ocaña et al., 2017
pancreas symmetry, abnormal	WT + MO2-spaw	Fig. S3 from Gamse et al., 2005
parapineal organ position, abnormal	zf15Tg + MO2-spaw	Fig. 2 from Kuan et al., 2007

Phenotype of all Fish created by or utilizing MO2-spaw

Phenotype	Fish	Conditions	Figures
lateral plate mesoderm prrx1a expression spatial pattern, abnormal	AB + MO2-spaw	standard conditions	Fig. 4 from Ocaña et al., 2017
determination of left/right symmetry disrupted, abnormal	WT + MO1-spaw + MO2-spaw	standard conditions	Fig. 3 from Smith et al., 2008
heart looping disrupted, abnormal	WT + MO1-spaw + MO2-spaw	standard conditions	Fig. 3 from Smith et al., 2008
pancreas symmetry, abnormal	WT + MO2-spaw	standard conditions	Fig. S3 from Gamse et al., 2005
habenula symmetry, abnormal	WT + MO2-spaw	standard conditions	Fig. S3 from Gamse et al., 2005
determination of pancreatic left/right asymmetry disrupted, abnormal	WT + MO2-spaw	standard conditions	Fig. S3 from Gamse et al., 2005
determination of left/right symmetry disrupted, abnormal	WT + MO2-spaw	standard conditions	Fig. S3 from Gamse et al., 2005
heart rudiment bilateral symmetry, abnormal	twu34Tg + MO2-spaw	standard conditions	Fig. 2 from Rohr et al., 2008
heart morphogenesis process quality, abnormal	twu34Tg + MO2-spaw	standard conditions	Fig. 2 from Rohr et al., 2008
determination of left/right symmetry disrupted, abnormal	zf15Tg + MO2-spaw	standard conditions	Fig. 2 from Kuan et al., 2007
parapineal organ position, abnormal	zf15Tg + MO2-spaw	standard conditions	Fig. 2 from Kuan et al., 2007
fasciculus retroflexus axon misrouted, abnormal	zf15Tg + MO2-spaw	standard conditions	Fig. 2 from Kuan et al., 2007

Citations