Morpholino

MO2-sema3d

ID
ZDB-MRPHLNO-051128-3
Name
MO2-sema3d
Previous Names
  • 3DMO (1)
Target
Sequence
5' - CATGATGGACGAGGAGATTTCTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sema3d
Expressed Gene Anatomy Figures
ccna2 Fig. 4 with image from Berndt et al., 2006
ccnd1 Fig. 4 with image from Berndt et al., 2006
cdh5 Fig. 6 with image from Hamm et al., 2016
cdkn1ca Fig. 4 with image from Berndt et al., 2006
crestin Fig. 1 with image,  Fig. 2 with image from Berndt et al., 2006
dlx2a Fig. 2 with image from Berndt et al., 2006
efna5a Fig. 6 from Liu et al., 2004
efnb2a Fig. 6 from Liu et al., 2004
egr2b text only from Berndt et al., 2006
foxd3 text only from Berndt et al., 2006
Fig. 4 with image from Sato et al., 2006
hoxa2b text only from Berndt et al., 2006
hoxb1a text only from Berndt et al., 2006
hoxb2a Fig. 1 with image from Berndt et al., 2006
hoxb3a text only from Berndt et al., 2006
l1camb Fig. 3 from Wolman et al., 2007
myl7 Fig. 5 with image,  Fig. 6 with image from Sato et al., 2006
rag1 Fig. 2 with image from Sato et al., 2006
snai1b text only from Berndt et al., 2006
tfap2a Fig. 4 with image from Sato et al., 2006
Phenotype
Phenotype resulting from MO2-sema3d
Phenotype Fish Figures
common cardinal vein decreased length, abnormal s843Tg + MO2-sema3d Fig. 1 with image from Hamm et al., 2016
common cardinal vein increased width, abnormal s843Tg + MO2-sema3d Fig. 1 with image from Hamm et al., 2016
common cardinal vein actin filament bundle disoriented, abnormal mu240Tg + MO2-sema3d Fig. 5 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein actin filament bundle organization decreased process quality, abnormal mu240Tg + MO2-sema3d Fig. 5 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell disorganized, abnormal mu240Tg + MO2-sema3d Fig. 1 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell shape, abnormal mu240Tg + MO2-sema3d Fig. 5 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell structure, cavities, abnormal mu240Tg + MO2-sema3d Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell migration decreased process quality, abnormal s843Tg + MO2-sema3d Fig. 1 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelium patchy, abnormal mu240Tg + MO2-sema3d Fig. 5 with image from Hamm et al., 2016
common cardinal vein cell-cell junction decreased length, abnormal WT + MO2-sema3d Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein cell-cell junction irregular spatial pattern, abnormal WT + MO2-sema3d Fig. 6 with image from Hamm et al., 2016
common cardinal vein cell-cell junction cdh5 expression spatial pattern, abnormal WT + MO2-sema3d Fig. 6 with image from Hamm et al., 2016
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal WT + MO2-sema3d Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
posterior lateral line neuromast primordium migration decreased process quality, abnormal zf106Tg + MO2-sema3d Fig. 10 with image from Hamm et al., 2016
posterior lateral line primordium malformed, abnormal zf106Tg + MO2-sema3d Fig. 10 with image from Hamm et al., 2016
Rohon-Beard neuron axon decreased amount, abnormal WT + MO2-sema3d Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
venous blood vessel morphogenesis decreased process quality, abnormal mu240Tg + MO2-sema3d Fig. 1 with image,  Fig. 8 with image from Hamm et al., 2016
Phenotype of all Fish created by or utilizing MO2-sema3d
Phenotype Fish Conditions Figures
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal WT + MO2-sema3d standard conditions Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
Rohon-Beard neuron axon decreased amount, abnormal WT + MO2-sema3d standard conditions Fig. 6 with image,  Fig. 9 with image from Tanaka et al., 2011
common cardinal vein cell-cell junction decreased length, abnormal WT + MO2-sema3d standard conditions Fig. 6 with image from Hamm et al., 2016
common cardinal vein cell-cell junction irregular spatial pattern, abnormal WT + MO2-sema3d standard conditions Fig. 6 with image from Hamm et al., 2016
common cardinal vein cell-cell junction cdh5 expression spatial pattern, abnormal WT + MO2-sema3d standard conditions Fig. 6 with image from Hamm et al., 2016
venous blood vessel morphogenesis decreased process quality, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 1 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelium patchy, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 5 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell disorganized, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 1 with image from Hamm et al., 2016
common cardinal vein actin filament bundle disoriented, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 5 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein actin filament bundle organization decreased process quality, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 5 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell shape, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 5 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell structure, cavities, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 8 with image from Hamm et al., 2016
common cardinal vein cell-cell junction decreased length, abnormal mu240Tg + MO2-sema3d standard conditions Fig. 5 with image,  Fig. 8 with image from Hamm et al., 2016
common cardinal vein blood vessel endothelial cell migration decreased process quality, abnormal s843Tg + MO2-sema3d standard conditions Fig. 1 with image from Hamm et al., 2016
venous blood vessel morphogenesis decreased process quality, abnormal s843Tg + MO2-sema3d standard conditions Fig. 1 with image from Hamm et al., 2016
common cardinal vein decreased length, abnormal s843Tg + MO2-sema3d standard conditions Fig. 1 with image from Hamm et al., 2016
common cardinal vein increased width, abnormal s843Tg + MO2-sema3d standard conditions Fig. 1 with image from Hamm et al., 2016
posterior lateral line primordium malformed, abnormal zf106Tg + MO2-sema3d control Fig. 10 with image from Hamm et al., 2016
posterior lateral line neuromast primordium migration decreased process quality, abnormal zf106Tg + MO2-sema3d control Fig. 10 with image from Hamm et al., 2016
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal WT + MO1-dpysl3 + MO2-sema3d standard conditions Fig. 9 with image from Tanaka et al., 2011
Rohon-Beard neuron axon decreased amount, abnormal WT + MO1-dpysl3 + MO2-sema3d standard conditions Fig. 9 with image from Tanaka et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.