Morpholino
MO2-sema3d
- ID
- ZDB-MRPHLNO-051128-3
- Name
- MO2-sema3d
- Previous Names
-
- 3DMO (1)
- Target
- Sequence
-
5' - CATGATGGACGAGGAGATTTCTGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sema3d
Expressed Gene | Anatomy | Figures |
---|---|---|
ccna2 |
Fig. 4 ![]() |
|
ccnd1 |
Fig. 4 ![]() |
|
cdh5 |
Fig. 6 ![]() |
|
cdkn1ca |
Fig. 4 ![]() |
|
crestin |
Fig. 1 ![]() ![]() |
1 - 5 of 19 Show all
Phenotype
Phenotype resulting from MO2-sema3d
1 - 5 of 17 Show all
Phenotype of all Fish created by or utilizing MO2-sema3d
1 - 5 of 21 Show all
Citations
- Hamm, M.J., Kirchmaier, B.C., Herzog, W. (2016) Sema3d controls collective endothelial cell migration by distinct mechanisms via Nrp1 and PlxnD1. The Journal of cell biology. 215(3):415-430
- Dell, A.L., Fried-Cassorla, E., Xu, H., and Raper, J.A. (2013) cAMP-Induced Expression of Neuropilin1 Promotes Retinal Axon Crossing in the Zebrafish Optic Chiasm. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(27):11076-11088
- Tanaka, H., Nojima, Y., Shoji, W., Sato, M., Nakayama, R., Ohshima, T., and Okamoto, H. (2011) Islet1 selectively promotes peripheral axon outgrowth in Rohon-Beard primary sensory neurons. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(1):9-22
- Wolman, M.A., Regnery, A.M., Becker, T., Becker, C.G., and Halloran, M.C. (2007) Semaphorin3D regulates axon axon interactions by modulating levels of L1 cell adhesion molecule. The Journal of neuroscience : the official journal of the Society for Neuroscience. 27(36):9653-9663
- Berndt, J.D., and Halloran, M.C. (2006) Semaphorin 3d promotes cell proliferation and neural crest cell development downstream of TCF in the zebrafish hindbrain. Development (Cambridge, England). 133(20):3983-3992
- Sakai, J.A., and Halloran, M.C. (2006) Semaphorin 3d guides laterality of retinal ganglion cell projections in zebrafish. Development (Cambridge, England). 133(6):1035-1044
- Sato, M., Tsai, H.J., and Yost, H.J. (2006) Semaphorin3D regulates invasion of cardiac neural crest cells into the primary heart field. Developmental Biology. 298(1):12-21
- Liu, Y., and Halloran, M.C. (2005) Central and peripheral axon branches from one neuron are guided differentially by Semaphorin3D and transient axonal glycoprotein-1. The Journal of neuroscience : the official journal of the Society for Neuroscience. 25(45):10556-10563
- Liu, Y., Berndt, J., Su, F., Tawarayama, H., Shoji, W., Kuwada, J.Y., and Halloran, M.C. (2004) Semaphorin3D guides retinal axons along the dorsoventral axis of the tectum. The Journal of neuroscience : the official journal of the Society for Neuroscience. 24(2):310-318
- Wolman, M.A., Liu, Y., Tawarayama, H., Shoji, W., and Halloran, M.C. (2004) Repulsion and attraction of axons by Semaphorin3D are mediated by different neuropilins in vivo. The Journal of neuroscience : the official journal of the Society for Neuroscience. 24(39):8428-8435
1 - 10 of 10
Show