Morpholino
MO1-mef2aa
- ID
- ZDB-MRPHLNO-050914-1
- Name
- MO1-mef2aa
- Previous Names
-
- GT-MO (1)
- MO1-mef2a
- Target
- Sequence
-
5' - GTCGTTTGTGCTCACCAGAGTTGTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mef2aa
Expressed Gene | Anatomy | Figures |
---|---|---|
ihhb |
Fig. 4 ![]() |
|
mef2aa |
|
Fig. 2
from Wang et al., 2005 |
mef2d |
Fig. 5
from Wang et al., 2005 |
|
myh6 |
Fig. 5
from Wang et al., 2005 |
|
myh7 |
Fig. 5
from Wang et al., 2005 |
1 - 5 of 13 Show all
Phenotype
Phenotype resulting from MO1-mef2aa
1 - 5 of 14 Show all
Phenotype of all Fish created by or utilizing MO1-mef2aa
1 - 5 of 14 Show all
Citations
- Jin, D., Ni, T.T., Hou, J., Rellinger, E., and Zhong, T.P. (2009) Promoter analysis of ventricular myosin heavy chain (vmhc) in zebrafish embryos. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(7):1760-1767
- Wang, Y.X., Qian, L.X., Liu, D., Yao, L.L., Jiang, Q., Yu, Z., Gui, Y.H., Zhong, T.P., and Song, H.Y. (2007) Bone morphogenetic protein-2 acts upstream of myocyte-specific enhancer factor 2a to control embryonic cardiac contractility. Cardiovascular research. 74(2):290-303
- Wang, Y., Qian, L., Dong, Y., Jiang, Q., Gui, Y., Zhong, T.P., and Song, H. (2006) Myocyte-specific enhancer factor 2A is essential for zebrafish posterior somite development. Mechanisms of Development. 123(10):783-791
- Wang, Y.X., Qian, L.X., Yu, Z., Jiang, Q., Dong, Y.X., Liu, X.F., Xin-Ying, Y., Zhong, T.P., and Song, H.Y. (2005) Requirements of myocyte-specific enhancer factor 2A in zebrafish cardiac contractility. FEBS letters. 579(21):4843-4850
1 - 4 of 4
Show