Morpholino

MO2-sp5l

ID
ZDB-MRPHLNO-050607-2
Name
MO2-sp5l
Previous Names
  • spr2-MO2 (1)
Target
Sequence
5' - CCCCCTTACACAGCCAGGTGCGTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sp5l
Phenotype
Phenotype resulting from MO2-sp5l
Phenotype of all Fish created by or utilizing MO2-sp5l
Phenotype Fish Conditions Figures
otic vesicle neurog1 expression decreased amount, abnormal AB + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression amount, ameliorated AB + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle pax5 expression amount, ameliorated AB + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal AB + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle pax5 expression spatial pattern, ameliorated AB + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression spatial pattern, ameliorated AB + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal AB + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle sp5l expression amount, ameliorated sp5ax69/x69 + MO2-sp5l standard conditions Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression spatial pattern, ameliorated sp5ax69/x69 + MO2-sp5l standard conditions Fig. 10 with image from Tan et al., 2022
otic vesicle pax5 expression spatial pattern, ameliorated sp5ax69/x69 + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression decreased amount, abnormal sp5ax69/x69 + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle pax5 expression amount, ameliorated sp5ax69/x69 + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal sp5ax69/x69 + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal sp5ax69/x69 + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
notochord truncated, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
post-anal tail morphogenesis disrupted, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
somite decreased amount, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
post-vent region decreased length, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1077Tg + MO1-sp5a + MO2-sp5l standard conditions Fig. 6 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1077Tg + MO1-sp5a + MO2-sp5l standard conditions Fig. 6 with image from Labalette et al., 2015
otic vesicle pax5 expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle sp5l expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased distribution, abnormal sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
otic vesicle sp5l expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle pax5 expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression spatial pattern, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic vesicle neurog1 expression amount, ameliorated sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l chemical treatment by environment: 6-bromoindirubin-3'-oxime Fig. 10 with image from Tan et al., 2022
otic placode atoh1a expression decreased amount, abnormal sp5ax69/x69; sp5lx70/x70 + MO1-sp5a + MO2-sp5l standard conditions Fig. 12 with image from Tan et al., 2022
Citations