Morpholino

MO1-shha

ID
ZDB-MRPHLNO-050204-6
Name
MO1-shha
Previous Names
  • MO(T)-shh
  • MO1-shh (1)
  • shh-MO (2)
Target
Sequence
5' - CAGCACTCTCGTCAAAAGCCGCATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation blocking morpholino against shh. Embryos have a normal head and u-shaped somites. The myoseptum is absent. The finbuds are reduced compared with wild type embryos.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-shha
Phenotype
Phenotype resulting from MO1-shha
Phenotype of all Fish created by or utilizing MO1-shha
Phenotype Fish Conditions Figures
pancreas primordium ab2-isl labeling decreased amount, abnormal AB + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
midbrain hindbrain boundary present, ameliorated AB + MO1-shha chemical treatment: ethanol, chemical treatment: retinoic acid Fig. 1 from Zhang et al., 2015
swimming behavior process quality, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 4Fig. 5 from Burton et al., 2017
swimming behavior disrupted, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 7Fig. 8 from Boa-Amponsem et al., 2020
midbrain hindbrain boundary absent, abnormal AB + MO1-shha chemical treatment: ethanol Fig. 1 from Zhang et al., 2015
hindbrain pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
pancreas primordium Ab8-ins labeling decreased amount, abnormal AB + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
eye decreased size, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 2Fig. 3 from Boa-Amponsem et al., 2020
endoderm glis3 expression absent, abnormal AB + MO1-shha control Fig. 5 from Rurale et al., 2019
forebrain pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment: ethanol Fig. 6 from Zhang et al., 2015
midbrain hindbrain boundary morphology, abnormal AB + MO1-shha standard conditions Fig. 5 from Zhang et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment: ethanol, chemical treatment: retinoic acid Fig. 6 from Zhang et al., 2015
brain glis3 expression absent, abnormal AB + MO1-shha control Fig. 5 from Rurale et al., 2019
eye pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
midbrain hindbrain boundary malformed, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 2 from Burton et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 3 from Burton et al., 2017
slow muscle cell nucleus decreased amount, abnormal WT + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
whole organism lacks all parts of type ceratobranchial 5 tooth, abnormal WT + MO1-shha standard conditions Fig. 3 with image from Jackman et al., 2010
somite muscle pioneer decreased amount, abnormal WT + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
odontogenesis arrested, abnormal WT + MO1-shha standard conditions Fig. 3 with image from Jackman et al., 2010
midbrain-hindbrain boundary development process quality, abnormal WT + MO1-shha chemical treatment: ethanol Fig. 10Fig. S1 from Zhang et al., 2014
eye decreased size, abnormal WT + MO1-shha chemical treatment: ethanol Fig. S1 from Zhang et al., 2014
pancreas primordium Ab8-ins labeling amount, ameliorated cq109Tg/cq109Tg + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling amount, ameliorated cq109Tg/cq109Tg + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
midbrain hindbrain boundary absent, abnormal AB + MO1-aldh1a3 + MO1-shha control Fig. 1 from Zhang et al., 2015
midbrain hindbrain boundary present, ameliorated AB + MO1-aldh1a3 + MO1-shha chemical treatment: retinoic acid Fig. 1 from Zhang et al., 2015
pancreas primordium Ab8-ins labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
slow muscle cell nucleus decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
somite muscle pioneer decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
odontogenesis delayed, abnormal WT + MO1-shha + MO2-shhb standard conditions Fig. 3 with image from Jackman et al., 2010
tooth placode position, abnormal WT + MO1-shha + MO2-shhb standard conditions Fig. 3 with image from Jackman et al., 2010
Citations