Morpholino

MO1-smad5

ID

ZDB-MRPHLNO-041217-8

Name

MO1-smad5

Previous Names

smad5 MO (1)

Target

smad5 (1)

Sequence

5' - AACAGACTAGACATGGAGGTCATAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

MODB:76 (2)

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-smad5

Expressed Gene	Anatomy	Figures
atoh1a	posterior lateral line primordium protoneuromast	Fig. 5 from Xing et al., 2015
cdh2	posterior lateral line primordium	Fig. 5 from Xing et al., 2015
cyp26a1	neuroectoderm	Fig. 4 from Wei et al., 2014
dla	posterior lateral line primordium protoneuromast	Fig. 5 from Xing et al., 2015
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 1 from Lele et al., 2001
foxi1	ectoderm	Fig. 4 from Wei et al., 2014
lcp1	macrophage	Fig. 7 from Wei et al., 2014
mpx	granulocyte	Fig. 7 from Wei et al., 2014
smad1	(not) whole organism	Fig. 5, Fig. 6 from Wei et al., 2014
smad9	(not) whole organism	Fig. 5, Fig. 6 from Wei et al., 2014
szl	whole organism ventral side	Fig. 4 from Wei et al., 2014

Phenotype

Phenotype resulting from MO1-smad5

Phenotype	Fish	Figures
dorsal/ventral pattern formation process quality, abnormal	WT + MO1-smad5	Fig. 1, Fig. 4 from Wei et al., 2014
hindbrain condensed, abnormal	WT + MO1-smad5	Fig. 1 from Lele et al., 2001
post-vent region decreased length, abnormal	WT + MO1-smad5	Fig. 1 from Lele et al., 2001
posterior lateral line neuromast decreased amount, abnormal	zf106Tg + MO1-smad5	Fig. 5 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal	zf106Tg + MO1-smad5 + MO5-tp53	Fig. 5 from Xing et al., 2015
rhombomere 3 increased length, abnormal	WT + MO1-smad5	Fig. 1 from Lele et al., 2001
rhombomere 5 increased length, abnormal	WT + MO1-smad5	Fig. 1 from Lele et al., 2001
somite circular, abnormal	WT + MO1-smad5	Fig. 1 from Lele et al., 2001
somite increased width, abnormal	WT + MO1-smad5	Fig. 1 from Lele et al., 2001
trunk condensed, abnormal	WT + MO1-smad5	Fig. 1 from Lele et al., 2001
whole organism wholly dorsalized, abnormal	WT + MO1-smad5	Fig. 1, Fig. 4 from Wei et al., 2014 Fig. 1 from Lele et al., 2001

Phenotype of all Fish created by or utilizing MO1-smad5

Phenotype	Fish	Conditions	Figures
somite circular, abnormal	WT + MO1-smad5	standard conditions	Fig. 1 from Lele et al., 2001
somite increased width, abnormal	WT + MO1-smad5	standard conditions	Fig. 1 from Lele et al., 2001
hindbrain condensed, abnormal	WT + MO1-smad5	standard conditions	Fig. 1 from Lele et al., 2001
dorsal/ventral pattern formation process quality, abnormal	WT + MO1-smad5	standard conditions	Fig. 1, Fig. 4 from Wei et al., 2014
whole organism wholly dorsalized, abnormal	WT + MO1-smad5	standard conditions	Fig. 1, Fig. 4 from Wei et al., 2014 Fig. 1 from Lele et al., 2001
rhombomere 5 increased length, abnormal	WT + MO1-smad5	standard conditions	Fig. 1 from Lele et al., 2001
rhombomere 3 increased length, abnormal	WT + MO1-smad5	standard conditions	Fig. 1 from Lele et al., 2001
trunk condensed, abnormal	WT + MO1-smad5	standard conditions	Fig. 1 from Lele et al., 2001
post-vent region decreased length, abnormal	WT + MO1-smad5	standard conditions	Fig. 1 from Lele et al., 2001
posterior lateral line neuromast decreased amount, abnormal	zf106Tg + MO1-smad5	standard conditions	Fig. 5 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal	zf106Tg + MO1-smad5	standard conditions	Fig. 5 from Xing et al., 2015
posterior lateral line neuromast decreased amount, abnormal	zf106Tg + MO1-smad5 + MO5-tp53	standard conditions	Fig. 5 from Xing et al., 2015
posterior lateral line neuromast far from posterior lateral line neuromast, abnormal	zf106Tg + MO1-smad5 + MO5-tp53	standard conditions	Fig. 5 from Xing et al., 2015
whole organism wholly dorsalized, abnormal	WT + MO1-smad5 + MO1-smad9	standard conditions	Fig. 3 from Wei et al., 2014
dorsal/ventral pattern formation process quality, abnormal	WT + MO1-smad5 + MO1-smad9	standard conditions	Fig. 3 from Wei et al., 2014
whole organism wholly dorsalized, abnormal	WT + MO1-smad5 + MO3-smad1	standard conditions	Fig. 1 from Wei et al., 2014
dorsal/ventral pattern formation process quality, abnormal	WT + MO1-smad5 + MO3-smad1	standard conditions	Fig. 1 from Wei et al., 2014

Citations