FIGURE

Fig. 2

ID

ZDB-FIG-231215-78

Publication

Baker et al., 2022 - In Toto imaging of early enteric nervous system Development reveals that gut colonization is tied to proliferation downstream of ret

Other Figures

All Figure Page

Back to All Figure Page

Fig. 2

A novel CRISPR-Cas9 generated ret zebrafish mutant. (A) Schematic of receptor tyrosine kinase gene, ret and its resulting mRNA. (B) Diagram depicting injection of sgRNA and Cas9 mRNA into ret+/+ Tg(−8.3phox2bb:Kaede) and crosses used to isolate single CRISPR generate lesion within ret allele. (C) Zoomed in region of coding sequence of exon 8 (red arrow) targeted by sgRNA sequence (GAGACAGCGAGGAGACTGTG, yellow highlight) adjacent to PAM motif (red highlight). CRISPR-Cas9 activity at this locus generated an 11 bp deletion that resulted in nonsense mutation (stop codon, asterisk). (D-F) Representative images (left) and resulting genotypes (right) from in-crossing F1 heterozygotes harboring nonsense mutation (retwmr1/+), which produces phenotypic WT (ret+/+) (D), hypoganglionosis or HSCR-like (retwmr1/+) (E) and total aganglionosis (retwmr1/ wmr1) (F). Scale bars: 100 µm. A, anterior; D, dorsal; P, posterior; V, ventral.

Expression Data

Gene:	Kaede
Fish:	ret^wmr1/+; em2Tg/em2Tg ret^wmr1/wmr1; em2Tg/em2Tg
Condition:	ultraviolet light
Anatomical Term:	gut migratory neural crest cell
Stage Range:	Long-pec to Protruding-mouth

Expression Detail

Antibody Labeling

Phenotype Data

Fish:	ret^wmr1/+; em2Tg/em2Tg ret^wmr1/wmr1; em2Tg/em2Tg
Condition:	ultraviolet light
Observed In:	enteric nervous system development gut migratory neural crest cell gut neural crest cell migration
Stage Range:	Long-pec to Protruding-mouth

Phenotype Detail

Acknowledgments

This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Development