CRISPR

CRISPR2-vps16

ID

ZDB-CRISPR-240809-3

Name

CRISPR2-vps16

Previous Names

None

Target

vps16 (1)

Sequence

5' - GGTGAAGCAGTTGGGATGGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
wsu4	vps16

Expression

Gene expression in Wild Types + CRISPR2-vps16

No data available

Phenotype

Phenotype resulting from CRISPR2-vps16

No data available

Phenotype of all Fish created by or utilizing CRISPR2-vps16

Phenotype	Fish	Conditions	Figures
forebrain apoptotic process increased process quality, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 3 from Banerjee et al., 2024
whole organism dead, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
retina degenerate, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
photoreceptor outer segment layer truncated, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
midbrain apoptotic process increased process quality, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 3 from Banerjee et al., 2024
swimming behavior decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	control	Fig. 4 from Banerjee et al., 2024
whole organism semi-viable, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
Muller cell reactive gliosis increased process quality, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 2 from Banerjee et al., 2024
short double cone cell cytoplasm zpr-1 labeling increased distribution, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 2 from Banerjee et al., 2024
hindbrain myelination decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 3 from Banerjee et al., 2024
retinal rod cell rod photoreceptor outer segment decreased length, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 2 from Banerjee et al., 2024
retinal rod cell rod photoreceptor outer segment zpr-3 labeling decreased distribution, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 2 from Banerjee et al., 2024
hindbrain apoptotic process increased process quality, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 3 from Banerjee et al., 2024
integument decreased pigmentation, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
habituation decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	mechanical stress	Fig. 7 from Banerjee et al., 2024
forebrain nucleus condensed, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
swimming behavior decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	mechanical stress	Fig. 7 from Banerjee et al., 2024
retina nucleus condensed, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
retina apoptotic process increased process quality, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 2 from Banerjee et al., 2024
swimming behavior decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	mechanical stress	Fig. 5 , Fig. 6 from Banerjee et al., 2024
long double cone cell cytoplasm zpr-1 labeling increased distribution, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 2 from Banerjee et al., 2024
retinal pigmented epithelium decreased pigmentation, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 1 from Banerjee et al., 2024
habituation decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	mechanical stress	Fig. 8 from Banerjee et al., 2024
midbrain myelination decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	standard conditions	Fig. 3 from Banerjee et al., 2024
habituation decreased process quality, abnormal	vps16^wsu4/wsu4 (AB)	mechanical stress	Fig. 6 from Banerjee et al., 2024

Citations