CRISPR

CRISPR4-thrb

ID

ZDB-CRISPR-210219-5

Name

CRISPR4-thrb

Previous Names

None

Target

thrb (1)

Sequence

5' - GGCAACACAGCCAACCCTAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nds2	thrb
nds3	thrb
q34	thrb

Expression

Gene expression in Wild Types + CRISPR4-thrb

No data available

Phenotype

Phenotype resulting from CRISPR4-thrb

No data available

Phenotype of all Fish created by or utilizing CRISPR4-thrb

Phenotype	Fish	Conditions	Figures
retina response to red light absent process, abnormal	thrb^nds2/nds2	standard conditions	Fig 9 from Deveau et al., 2020
retinal cone cell response to red light decreased magnitude, abnormal	thrb^nds2/nds2	standard conditions	Fig 10 , Fig 15 from Deveau et al., 2020
retinal cone cell response to red light absent process, abnormal	thrb^nds2/nds2	standard conditions	Fig 6 , Fig 14 from Deveau et al., 2020
optokinetic behavior decreased occurrence, abnormal	thrb^nds2/nds2	standard conditions	Fig 13 from Deveau et al., 2020
retinal cone cell cellular response to UV increased magnitude, abnormal	thrb^nds2/nds2	standard conditions	Fig 10 , Fig 15 from Deveau et al., 2020
retinal cone cell rho expression absent, abnormal	thrb^nds2/nds2	standard conditions	Fig 4 from Deveau et al., 2020
retinal cone cell zpr-1 labeling absent, abnormal	thrb^nds2/nds2	standard conditions	Fig 4 from Deveau et al., 2020
optomotor response absent process, abnormal	thrb^nds2/nds2	standard conditions	Fig 12 from Deveau et al., 2020
long double cone cell absent, abnormal	thrb^q34/q34	standard conditions	Fig 6 from Nunley et al., 2020
retinal cone cell response to red light decreased magnitude, abnormal	thrb^nds2/+	standard conditions	Fig 10 from Deveau et al., 2020
retinal cone cell rho expression spatial pattern, abnormal	thrb^nds2/+	standard conditions	Fig 4 from Deveau et al., 2020
retinal cone cell cellular response to UV increased magnitude, abnormal	thrb^nds2/+	standard conditions	Fig 10 from Deveau et al., 2020
retinal cone cell zpr-1 labeling spatial pattern, abnormal	thrb^nds2/+	standard conditions	Fig 4 from Deveau et al., 2020
retinal cone cell response to red light amplitude, abnormal	thrb^nds3/+	standard conditions	Fig 8 from Deveau et al., 2020
long double cone cell rho expression absent, abnormal	thrb^nds2/nds2; q22Tg	standard conditions	Fig 3 from Deveau et al., 2020
retinal cone cell Tomato expression absent, abnormal	thrb^nds2/nds2; q22Tg	standard conditions	Fig 2 from Deveau et al., 2020
long double cone cell Tomato expression absent, abnormal	thrb^nds2/nds2; q22Tg	standard conditions	Fig 3 from Deveau et al., 2020

Citations