CRISPR

CRISPR4-amh

ID
ZDB-CRISPR-210218-1
Name
CRISPR4-amh
Previous Names
None
Target
Sequence
5' - GGTCGTATTGTGCTACAGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umo17 amh
Expression
Gene expression in Wild Types + CRISPR4-amh
No data available
Phenotype
Phenotype resulting from CRISPR4-amh
No data available
Phenotype of all Fish created by or utilizing CRISPR4-amh
Phenotype Fish Conditions Figures
hypophysis male organism fshb expression increased amount, abnormal amhumo17/umo17 standard conditions Fig. 7 with image from Zhang et al., 2020
ovary decreased size, abnormal amhumo17/umo17 standard conditions Fig. 4 with image from Zhang et al., 2020
ovarian follicle stage I increased amount, abnormal amhumo17/umo17 standard conditions Fig. 4 with image from Zhang et al., 2020
male sex differentiation process quality, abnormal amhumo17/umo17 standard conditions Fig. 3 with image from Zhang et al., 2020
ovary increased size, abnormal amhumo17/umo17 standard conditions Fig. 4 with image from Zhang et al., 2020
testis hypertrophic, abnormal amhumo17/umo17 standard conditions Fig. 3 with image from Zhang et al., 2020
female organism female sterile, abnormal amhumo17/umo17 standard conditions Fig. 4 with image from Zhang et al., 2020
hypophysis male organism fshb expression decreased amount, abnormal amhumo17/umo17 standard conditions Fig. 5 with image from Zhang et al., 2020
female mating behavior decreased occurrence, abnormal amhumo17/umo17 standard conditions Fig. 4 with image from Zhang et al., 2020
spermatogonium increased amount, abnormal amhumo17/umo17 standard conditions Fig. 3 with image from Zhang et al., 2020
testis inha expression increased amount, abnormal amhumo17/umo17 standard conditions Fig. 6 with image from Zhang et al., 2020
sperm decreased amount, abnormal amhumo17/umo17 standard conditions Fig. 3 with image from Zhang et al., 2020
spermatocyte decreased amount, abnormal amhumo17/umo17 standard conditions Fig. 3 with image from Zhang et al., 2020
hypophysis female organism fshb expression increased amount, abnormal amhumo17/+; inhaumo19/umo19 standard conditions Fig. 6 with image from Zhang et al., 2020
hypophysis male organism fshb expression decreased amount, abnormal amhumo17/umo17; inhaumo19/+ standard conditions Fig. 6 with image from Zhang et al., 2020
hypophysis female organism fshb expression decreased amount, abnormal amhumo17/umo17; inhaumo19/+ standard conditions Fig. 6 with image from Zhang et al., 2020
testis increased size, abnormal amhumo17/umo17; inhaumo19/umo19 standard conditions Fig. 6 with image from Zhang et al., 2020
ovarian follicle stage I increased amount, abnormal amhumo17/umo17; inhaumo19/umo19 standard conditions Fig. 6 with image from Zhang et al., 2020
testis hypertrophic, abnormal amhumo17/umo17; inhaumo19/umo19 standard conditions Fig. 6 with image from Zhang et al., 2020
ovary increased size, abnormal amhumo17/umo17; inhaumo19/umo19 standard conditions Fig. 6 with image from Zhang et al., 2020
ovarian follicle stage II increased amount, abnormal amhumo17/umo17; inhaumo19/umo19 standard conditions Fig. 6 with image from Zhang et al., 2020
spermatogonium increased amount, abnormal amhumo17/umo17; inhaumo19/umo19 standard conditions Fig. 6 with image from Zhang et al., 2020
testis hypertrophic, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
hypophysis fshb expression decreased amount, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis accumulation spermatogonium, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
male organism gonad increased weight, abnormal bmpr2aumo25/+; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis hypertrophic, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
hypophysis fshb expression decreased amount, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis accumulation spermatogonium, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
male organism gonad increased weight, abnormal bmpr2aumo25/umo25; amhumo17/+ (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
hypophysis fshb expression decreased amount, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis hypertrophic, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis accumulation spermatogonium, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
whole organism semi-fertile, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
male organism gonad increased weight, abnormal bmpr2aumo25/umo25; amhumo17/umo17 (AB) standard conditions Fig. 4 with image from Zhang et al., 2020
testis hypertrophic, abnormal fshbumo1/+; amhumo17/umo17 standard conditions Fig. 7 with image from Zhang et al., 2020
spermatogenesis process quality, abnormal fshbumo1/+; amhumo17/umo17 standard conditions Fig. 7 with image from Zhang et al., 2020
testis increased area, abnormal fshbumo1/+; amhumo17/umo17 standard conditions Fig. 7 with image from Zhang et al., 2020
ovary gamete generation disrupted, abnormal fshbumo1/+; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
testis cell population proliferation increased process quality, abnormal fshbumo1/+; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
ovary cell population proliferation increased process quality, abnormal fshbumo1/+; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
ovary oocyte differentiation decreased process quality, abnormal fshbumo1/+; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
gonad hypertrophic, abnormal fshbumo1/+; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
testis spermatid differentiation decreased process quality, abnormal fshbumo1/+; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
testis gamete generation disrupted, abnormal fshbumo1/+; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
female organism developmental process involved in reproduction delayed, abnormal fshbumo1/umo1; amhumo17/+ standard conditions Fig. 7 with image from Zhang et al., 2020
female organism follicle cell of egg chamber development delayed, abnormal fshbumo1/umo1; amhumo17/+ standard conditions Fig. 7 with image from Zhang et al., 2020
spermatogenesis delayed, abnormal fshbumo1/umo1; amhumo17/+ standard conditions Fig. 7 with image from Zhang et al., 2020
testis hypotrophic, abnormal fshbumo1/umo1; amhumo17/+ standard conditions Fig. 7 with image from Zhang et al., 2020
female organism developmental process involved in reproduction delayed, abnormal fshbumo1/umo1; amhumo17/umo17 standard conditions Fig. 7 with image from Zhang et al., 2020
female organism follicle cell of egg chamber development delayed, abnormal fshbumo1/umo1; amhumo17/umo17 standard conditions Fig. 7 with image from Zhang et al., 2020
ovary gamete generation disrupted, abnormal fshbumo1/umo1; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
testis cell population proliferation increased process quality, abnormal fshbumo1/umo1; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
ovary cell population proliferation increased process quality, abnormal fshbumo1/umo1; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
ovary oocyte differentiation decreased process quality, abnormal fshbumo1/umo1; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
gonad hypertrophic, abnormal fshbumo1/umo1; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
testis gamete generation disrupted, abnormal fshbumo1/umo1; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
testis spermatid differentiation decreased process quality, abnormal fshbumo1/umo1; amhumo17/umo17 (AB) standard conditions Fig. 1 with image from Zhang et al., 2020
ovary hypertrophic, abnormal fshrumo3/+; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
ovary accumulation ovarian follicle stage I, abnormal fshrumo3/+; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
ovary hypotrophic, abnormal fshrumo3/umo3; amhumo17/+ (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
ovarian follicle stage I immature, abnormal fshrumo3/umo3; amhumo17/+ (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
ovarian follicle stage I decreased amount, abnormal fshrumo3/umo3; amhumo17/+ (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
male organism increased amount, abnormal fshrumo3/umo3; amhumo17/umo17 standard conditions Fig. 10 with image from Zhang et al., 2020
sex differentiation process quality, abnormal fshrumo3/umo3; amhumo17/umo17 standard conditions Fig. 10 with image from Zhang et al., 2020
ovary hypotrophic, abnormal fshrumo3/umo3; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
ovarian follicle stage I immature, abnormal fshrumo3/umo3; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
ovarian follicle stage I decreased amount, abnormal fshrumo3/umo3; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis hypertrophic, abnormal gdf9umo18/+; amhumo17/umo17 standard conditions Fig. 8 with image from Zhang et al., 2020
testis hypertrophic, abnormal gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 8 with image from Zhang et al., 2020
ovary increased size, abnormal gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 8 with image from Zhang et al., 2020
ovary increased size, abnormal fshbumo1/+; gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 9 with image from Zhang et al., 2020
ovary decreased size, abnormal fshbumo1/umo1; gdf9umo18/umo18; amhumo17/umo17 standard conditions Fig. 9 with image from Zhang et al., 2020
testis hypertrophic, abnormal fshrumo3/+; lhcgrumo4/+; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis meiosis I decreased process quality, abnormal fshrumo3/+; lhcgrumo4/+; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis spermatogenesis disrupted, abnormal fshrumo3/+; lhcgrumo4/+; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis meiosis I disrupted, abnormal fshrumo3/umo3; lhcgrumo4/umo4; amhumo17/+ (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis spermatogenesis disrupted, abnormal fshrumo3/umo3; lhcgrumo4/umo4; amhumo17/+ (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis hypotrophic, abnormal fshrumo3/umo3; lhcgrumo4/umo4; amhumo17/+ (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
ovarian follicle stage I developmental cell growth arrested, abnormal fshrumo3/umo3; lhcgrumo4/umo4; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis meiosis I disrupted, abnormal fshrumo3/umo3; lhcgrumo4/umo4; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis hypotrophic, abnormal fshrumo3/umo3; lhcgrumo4/umo4; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
testis spermatogenesis disrupted, abnormal fshrumo3/umo3; lhcgrumo4/umo4; amhumo17/umo17 (AB) standard conditions Fig. 2 with image from Zhang et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.