CRISPR

CRISPR1-thrb

ID
ZDB-CRISPR-190809-3
Name
CRISPR1-thrb
Previous Names
None
Target
Sequence
5' - GGGTGAGTTATGCACCATGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-thrb
Expressed Gene Anatomy Figures
dio2 Fig. 5 from Lazcano et al., 2019
dio3a Fig. 5 from Lazcano et al., 2019
ets1 Fig. 6 from Lazcano et al., 2019
eve1 Fig. 6 from Lazcano et al., 2019
fgf1b Fig. 6 from Lazcano et al., 2019
foxd3 Fig. 6 from Lazcano et al., 2019
mbpa Fig. 7 from Lazcano et al., 2019
mpz Fig. 7 from Lazcano et al., 2019
msx1a Fig. 6 from Lazcano et al., 2019
olig2 Fig. 7 from Lazcano et al., 2019
pax7a Fig. 6 from Lazcano et al., 2019
plp1b Fig. 7 from Lazcano et al., 2019
slc16a2 Fig. 5 from Lazcano et al., 2019
sox10 Fig. 6 from Lazcano et al., 2019
thraa Fig. 5 from Lazcano et al., 2019
thrab Fig. 5 from Lazcano et al., 2019
thrb Fig. 5 from Lazcano et al., 2019
zic1 Fig. 6 from Lazcano et al., 2019
Phenotype
Phenotype resulting from CRISPR1-thrb
Phenotype Fish Figures
caudal fin deformed, abnormal WT + CRISPR1-thrb Fig. 3 with image from Lazcano et al., 2019
eye morphology, abnormal WT + CRISPR1-thrb Fig. 3 with image from Lazcano et al., 2019
eye position, abnormal WT + CRISPR1-thrb Fig. 3 with image from Lazcano et al., 2019
whole organism decreased life span, abnormal WT + CRISPR1-thrb Fig. 3 with image from Lazcano et al., 2019
whole organism decreased size, abnormal WT + CRISPR1-thrb Fig. 3 with image from Lazcano et al., 2019
whole organism sox10 expression increased amount, abnormal WT + CRISPR1-thrb Fig. 6 from Lazcano et al., 2019
whole organism eve1 expression increased amount, abnormal WT + CRISPR1-thrb Fig. 6 from Lazcano et al., 2019
whole organism ets1 expression increased amount, abnormal WT + CRISPR1-thrb Fig. 6 from Lazcano et al., 2019
whole organism symmetry, abnormal WT + CRISPR1-thrb Fig. 3 with image from Lazcano et al., 2019
Phenotype of all Fish created by or utilizing CRISPR1-thrb
Phenotype Fish Conditions Figures
whole organism symmetry, abnormal WT + CRISPR1-thrb standard conditions Fig. 3 with image from Lazcano et al., 2019
whole organism ets1 expression increased amount, abnormal WT + CRISPR1-thrb standard conditions Fig. 6 from Lazcano et al., 2019
eye morphology, abnormal WT + CRISPR1-thrb standard conditions Fig. 3 with image from Lazcano et al., 2019
eye position, abnormal WT + CRISPR1-thrb standard conditions Fig. 3 with image from Lazcano et al., 2019
caudal fin deformed, abnormal WT + CRISPR1-thrb standard conditions Fig. 3 with image from Lazcano et al., 2019
whole organism decreased life span, abnormal WT + CRISPR1-thrb standard conditions Fig. 3 with image from Lazcano et al., 2019
whole organism decreased size, abnormal WT + CRISPR1-thrb standard conditions Fig. 3 with image from Lazcano et al., 2019
whole organism eve1 expression increased amount, abnormal WT + CRISPR1-thrb standard conditions Fig. 6 from Lazcano et al., 2019
whole organism sox10 expression increased amount, abnormal WT + CRISPR1-thrb standard conditions Fig. 6 from Lazcano et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.