CRISPR

CRISPR1-foxf2a

ID
ZDB-CRISPR-190103-13
Name
CRISPR1-foxf2a
Previous Names
None
Target
Sequence
5' - GGCATCCAACAGCATGCACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el616 foxf2a
Expression
Gene expression in Wild Types + CRISPR1-foxf2a
No data available
Phenotype
Phenotype resulting from CRISPR1-foxf2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-foxf2a
Phenotype Fish Conditions Figures
basihyal cartilage decreased size, abnormal foxf1el658/el658; foxf2ael616/el616 standard conditions Fig. 3 with image from Xu et al., 2018
basibranchial morphology, abnormal foxf1el658/el658; foxf2ael616/el616 standard conditions Fig. 3 with image from Xu et al., 2018
ceratohyal cartilage decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type basibranchial, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
pterygoid process decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type basihyal cartilage, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
whole organism has fewer parts of type ceratobranchial 5 tooth, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
pharyngeal arch 1 hand2 expression decreased distribution, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/+ standard conditions Fig. 4 with image from Xu et al., 2018
Meckel's cartilage decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/+ standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage col2a1a expression decreased distribution, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
pharyngeal arch 1 cartilage development decreased occurrence, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type tooth 4V, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ethmoid cartilage decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ceratohyal cartilage decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ceratobranchial 5 primary tooth fgf3 expression absent, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
ceratobranchial 5 primary tooth dlx2b expression absent, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type tooth 5V, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage matn4 expression decreased distribution, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
whole organism lacks all parts of type basibranchial, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
neurocranium cartilage development decreased occurrence, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type neurocranial trabecula, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism lacks all parts of type tooth 3V, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage matn1 expression decreased distribution, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
whole organism lacks all parts of type basihyal cartilage, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
whole organism has fewer parts of type ceratobranchial 5 tooth, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
pterygoid process decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
pharyngeal arch 2 cartilage development decreased occurrence, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Meckel's cartilage acana expression decreased distribution, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 5 with image from Xu et al., 2018
head decreased size, abnormal foxf1el658/el658; foxf2ael616/el616; foxf2bel621/el621 standard conditions Fig. 3 with image from Xu et al., 2018
Citations