TALEN

TALEN1-gata6

ID
ZDB-TALEN-210322-2
Name
TALEN1-gata6
Previous Names
None
Target
Target Sequence 1
5' - CTTCCTCCCGGCGGATCGGA - 3'
Target Sequence 2
5' - GTTGTGGTGCTCGTCTGACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
wcm7 gata6
Expression
Gene expression in Wild Types + TALEN1-gata6
No data available
Phenotype
Phenotype resulting from TALEN1-gata6
No data available
Phenotype of all Fish created by or utilizing TALEN1-gata6
Phenotype Fish Conditions Figures
heart development disrupted, abnormal gata6wcm7/wcm7 standard conditions Fig. 10. with imageFig. 11. with image from Sam et al., 2020
ventricular cardiac muscle cell differentiation decreased process quality, abnormal gata6wcm7/wcm7 standard conditions Fig. 10. with image from Sam et al., 2020
atrium increased area, abnormal gata6wcm7/wcm7 standard conditions Fig. 8. with image from Sam et al., 2020
whole organism dead, abnormal gata6wcm7/wcm7 standard conditions text only from Sam et al., 2020
heart ltbp3 expression decreased amount, abnormal gata6wcm7/wcm7 standard conditions Fig. 11. with image from Sam et al., 2020
atrial cardiac muscle cell differentiation decreased process quality, abnormal gata6wcm7/wcm7 standard conditions Fig. 10. with image from Sam et al., 2020
cardiac ventricle decreased size, abnormal gata6wcm7/wcm7 standard conditions Fig. 7. with image from Sam et al., 2020
pericardium edematous, abnormal gata6wcm7/wcm7 standard conditions Fig. 1. with image from Sam et al., 2020
atrium increased size, abnormal gata6wcm7/wcm7; f2Tg; twu34Tg standard conditions Fig. 9. with image from Sam et al., 2020
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal gata6wcm7/wcm7; f2Tg; twu34Tg standard conditions Fig. 9. with image from Sam et al., 2020
heart primordium nkx2.5 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/+ standard conditions Fig. 3. with image from Sam et al., 2020
cardiac muscle cell myl7 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/+ standard conditions Fig. 3. with image from Sam et al., 2020
heart primordium absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
cardiac muscle cell absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
heart tube absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
cardiac muscle cell myl7 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
heart primordium nkx2.5 expression absent, abnormal gata5wcm8/wcm8; gata6wcm7/wcm7 standard conditions Fig. 3. with image from Sam et al., 2020
cardiac ventricle decreased size, abnormal gata6wcm7/wcm7; gata4wcm6/+ standard conditions Fig. 7. with image from Sam et al., 2020
heart ltbp3 expression decreased amount, abnormal gata6wcm7/wcm7; gata4wcm6/wcm6 standard conditions Fig. 11. with image from Sam et al., 2020
cardiac ventricle decreased size, exacerbated gata6wcm7/wcm7; gata4wcm6/wcm6 standard conditions Fig. 7. with image from Sam et al., 2020
heart tube decreased thickness, abnormal gata5wcm8/+; gata6wcm7/+; gata4wcm6/+ standard conditions Fig. 6. with image from Sam et al., 2020
heart tube straight, abnormal gata5wcm8/+; gata6wcm7/+; gata4wcm6/+ standard conditions Fig. 6. with image from Sam et al., 2020
heart tube absent, abnormal gata5wcm8/+; gata6wcm7/wcm7; gata4wcm6/wcm6 standard conditions Fig. 6. with image from Sam et al., 2020
heart tube absent, abnormal gata5wcm8/wcm8; gata6wcm7/+; gata4wcm6/wcm6 standard conditions Fig. 6. with image from Sam et al., 2020
Citations