TALEN

TALEN1-fshb

ID

ZDB-TALEN-150302-1

Name

TALEN1-fshb

Previous Names

None

Target

fshb (1)

Target Sequence 1

5' - GCGTGTGCTTGTTCTGGCGCTG - 3'

Target Sequence 2

5' - GATTCTGCGCTCATTAACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
umo1	fshb

Expression

Gene expression in Wild Types + TALEN1-fshb

No data available

Phenotype

Phenotype resulting from TALEN1-fshb

No data available

Phenotype of all Fish created by or utilizing TALEN1-fshb

Phenotype	Fish	Conditions	Figures
sex determination process quality, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 14 from Zhang et al., 2015
vitellogenesis delayed, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 5 from Zhang et al., 2015
spermatogenesis delayed, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 12 from Zhang et al., 2015
testis decreased size, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 12 from Zhang et al., 2015
ovary decreased size, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 5 from Zhang et al., 2015
female gonad development delayed, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 5 from Zhang et al., 2015
ovary immature, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 5 from Zhang et al., 2015
ovarian follicle development delayed, abnormal	fshb^umo1/umo1 (AB)	standard conditions	Fig. 8, Fig. 9 from Zhang et al., 2015
testis hypertrophic, abnormal	fshb^umo1/+; amh^umo17/umo17	standard conditions	Fig. 7 from Zhang et al., 2020
spermatogenesis process quality, abnormal	fshb^umo1/+; amh^umo17/umo17	standard conditions	Fig. 7 from Zhang et al., 2020
testis increased area, abnormal	fshb^umo1/+; amh^umo17/umo17	standard conditions	Fig. 7 from Zhang et al., 2020
ovary oocyte differentiation decreased process quality, abnormal	fshb^umo1/+; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
gonad hypertrophic, abnormal	fshb^umo1/+; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
ovary gamete generation disrupted, abnormal	fshb^umo1/+; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
testis spermatid differentiation decreased process quality, abnormal	fshb^umo1/+; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
testis gamete generation disrupted, abnormal	fshb^umo1/+; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
testis cell population proliferation increased process quality, abnormal	fshb^umo1/+; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
ovary cell population proliferation increased process quality, abnormal	fshb^umo1/+; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
female organism developmental process involved in reproduction delayed, abnormal	fshb^umo1/umo1; amh^umo17/+	standard conditions	Fig. 7 from Zhang et al., 2020
spermatogenesis delayed, abnormal	fshb^umo1/umo1; amh^umo17/+	standard conditions	Fig. 7 from Zhang et al., 2020
testis hypotrophic, abnormal	fshb^umo1/umo1; amh^umo17/+	standard conditions	Fig. 7 from Zhang et al., 2020
female organism follicle cell of egg chamber development delayed, abnormal	fshb^umo1/umo1; amh^umo17/+	standard conditions	Fig. 7 from Zhang et al., 2020
female organism developmental process involved in reproduction delayed, abnormal	fshb^umo1/umo1; amh^umo17/umo17	standard conditions	Fig. 7 from Zhang et al., 2020
female organism follicle cell of egg chamber development delayed, abnormal	fshb^umo1/umo1; amh^umo17/umo17	standard conditions	Fig. 7 from Zhang et al., 2020
ovary oocyte differentiation decreased process quality, abnormal	fshb^umo1/umo1; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
ovary gamete generation disrupted, abnormal	fshb^umo1/umo1; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
gonad hypertrophic, abnormal	fshb^umo1/umo1; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
testis gamete generation disrupted, abnormal	fshb^umo1/umo1; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
testis cell population proliferation increased process quality, abnormal	fshb^umo1/umo1; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
testis spermatid differentiation decreased process quality, abnormal	fshb^umo1/umo1; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
ovary cell population proliferation increased process quality, abnormal	fshb^umo1/umo1; amh^umo17/umo17 (AB)	standard conditions	Fig. 1 from Zhang et al., 2020
gonad development delayed, abnormal	fshb^umo1/umo1; lhb^umo2/umo2	standard conditions	Fig. 16 from Zhang et al., 2015
sex determination process quality, abnormal	fshb^umo1/umo1; lhb^umo2/umo2	standard conditions	Fig. 17 from Zhang et al., 2015
male sex determination increased occurrence, abnormal	fshb^umo1/umo1; lhb^umo2/umo2	standard conditions	Fig. 17 from Zhang et al., 2015
male gonad development delayed, abnormal	fshb^umo1/umo1; lhb^umo2/umo2	standard conditions	Fig. 17 from Zhang et al., 2015
ovary increased size, abnormal	fshb^umo1/+; gdf9^umo18/umo18; amh^umo17/umo17	standard conditions	Fig. 9 from Zhang et al., 2020
ovary decreased size, abnormal	fshb^umo1/umo1; gdf9^umo18/umo18; amh^umo17/umo17	standard conditions	Fig. 9 from Zhang et al., 2020

Citations