Morpholino

MO1-adsl

ID

ZDB-MRPHLNO-231025-1

Name

MO1-adsl

Previous Names

None

Target

adsl (1)

Sequence

5' - TCCCTCCATGCCTGCAGCGGTTAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-adsl

Expressed Gene	Anatomy	Figures
spaw	lateral plate mesoderm	Figure 7 from Dutto et al., 2022

Phenotype

Phenotype resulting from MO1-adsl

Phenotype	Fish	Figures
brain decreased size, abnormal	AB/EKW + MO1-adsl	Figure 6 from Dutto et al., 2022
brain hydrocephalic, abnormal	AB/EKW + MO1-adsl	Figure 6 from Dutto et al., 2022
cranium aplastic/hypoplastic, abnormal	AB/EKW + MO1-adsl	Figure 6 from Dutto et al., 2022
determination of left/right symmetry disrupted, abnormal	AB/EKW + MO1-adsl	Figure 7 from Dutto et al., 2022
forebrain neuroblast decreased amount, abnormal	AB/EKW + MO1-adsl	Figure 8 from Dutto et al., 2022
heart mislocalised laterally, abnormal	AB/EKW + MO1-adsl	Figure 7 from Dutto et al., 2022
heart looping disrupted, abnormal	AB/EKW + MO1-adsl	Figure 7 from Dutto et al., 2022
Kupffer's vesicle cilium decreased length, abnormal	AB/EKW + MO1-adsl	Figure 7 from Dutto et al., 2022
lateral plate mesoderm spaw expression increased distribution, abnormal	AB/EKW + MO1-adsl	Figure 7 from Dutto et al., 2022
lateral plate mesoderm spaw expression spatial pattern, abnormal	AB/EKW + MO1-adsl	Figure 7 from Dutto et al., 2022
liver mislocalised laterally, abnormal	AB/EKW + MO1-adsl	Figure 7 from Dutto et al., 2022
neural tube DNA damage response increased occurrence, abnormal	AB/EKW + MO1-adsl	Figure 6 from Dutto et al., 2022
neural tube neuron Ab4-elavl labeling decreased amount, abnormal	AB/EKW + MO1-adsl	Figure 8 from Dutto et al., 2022
pericardium edematous, abnormal	AB/EKW + MO1-adsl	Figure 6 from Dutto et al., 2022
post-vent region kinked, abnormal	AB/EKW + MO1-adsl	Figure 6 from Dutto et al., 2022

Phenotype of all Fish created by or utilizing MO1-adsl

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 6 from Dutto et al., 2022
post-vent region kinked, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 6 from Dutto et al., 2022
determination of left/right symmetry disrupted, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 7 from Dutto et al., 2022
forebrain neuroblast decreased amount, ameliorated	AB/EKW + MO1-adsl	chemical treatment by environment: methotrexate	Figure 8 from Dutto et al., 2022
lateral plate mesoderm spaw expression spatial pattern, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 7 from Dutto et al., 2022
heart mislocalised laterally, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 7 from Dutto et al., 2022
forebrain neuroblast decreased amount, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 8 from Dutto et al., 2022
liver mislocalised laterally, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 7 from Dutto et al., 2022
neural tube neuron Ab4-elavl labeling decreased amount, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 8 from Dutto et al., 2022
lateral plate mesoderm spaw expression increased distribution, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 7 from Dutto et al., 2022
Kupffer's vesicle cilium decreased length, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 7 from Dutto et al., 2022
cranium aplastic/hypoplastic, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 6 from Dutto et al., 2022
neural tube neuron Ab4-elavl labeling amount, ameliorated	AB/EKW + MO1-adsl	chemical treatment by environment: methotrexate	Figure 8 from Dutto et al., 2022
heart looping disrupted, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 7 from Dutto et al., 2022
brain decreased size, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 6 from Dutto et al., 2022
brain hydrocephalic, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 6 from Dutto et al., 2022
neural tube DNA damage response increased occurrence, abnormal	AB/EKW + MO1-adsl	standard conditions	Figure 6 from Dutto et al., 2022

Citations