Morpholino

MO1-fars2

ID

ZDB-MRPHLNO-230123-1

Name

MO1-fars2

Previous Names

None

Target

fars2 (1)

Sequence

5' - CATAGTAGCTGGTCCATAAGCCTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fars2

Expressed Gene	Anatomy	Figures
axin1	whole organism	Figure 5 from Li et al., 2021
ctnnb1	whole organism	Figure 5 from Li et al., 2021
dkk1b	whole organism	Figure 5 from Li et al., 2021
gsk3ba	whole organism	Figure 5 from Li et al., 2021
hey2	whole organism	Figure 5 from Li et al., 2021
lef1	whole organism	Figure 5 from Li et al., 2021
notch1b	whole organism	Figure 5 from Li et al., 2021
wnt9a	whole organism	Figure 5 from Li et al., 2021

Phenotype

Phenotype resulting from MO1-fars2

Phenotype	Fish	Figures
angiogenic sprout decreased amount, abnormal	y1Tg + MO1-fars2	Figure 2 from Li et al., 2021
caudal vein plexus morphology, abnormal	y1Tg + MO1-fars2	Figure 2 from Li et al., 2021
developmental growth delayed, abnormal	AB + MO1-fars2	Figure 1 from Li et al., 2021
heart decreased functionality, abnormal	AB + MO1-fars2	text only from Li et al., 2024
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-fars2	Figure 2 from Li et al., 2021
intersegmental vessel decreased length, abnormal	y1Tg + MO1-fars2	Figure 2 from Li et al., 2021
motor neuron axon decreased length, abnormal	AB + MO1-fars2	Fig. 7 from Chen et al., 2022
myotome C-shaped, abnormal	AB + MO1-fars2	Fig. 7 from Chen et al., 2022
parachordal vessel morphology, abnormal	y1Tg + MO1-fars2	Figure 2 from Li et al., 2021
pericardium edematous, abnormal	AB + MO1-fars2	Figure 2. from Li et al., 2024
post-vent region curved, abnormal	AB + MO1-fars2	Fig. 7 from Chen et al., 2022
trunk curved, abnormal	AB + MO1-fars2	Figure 1 from Li et al., 2021
whole organism dead, abnormal	AB + MO1-fars2	Fig. 7 from Chen et al., 2022
whole organism lef1 expression decreased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism ctnnb1 expression decreased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism wnt9a expression decreased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism gsk3ba expression decreased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism axin1 expression decreased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism decreased life span, abnormal	AB + MO1-fars2	Figure 1 from Li et al., 2021
whole organism hey2 expression increased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism notch1b expression increased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism dkk1b expression increased amount, abnormal	AB + MO1-fars2	Figure 5 from Li et al., 2021
whole organism viability, abnormal	AB + MO1-fars2	Fig. 7 from Chen et al., 2022
yolk syncytial layer increased size, abnormal	AB + MO1-fars2	Figure 1 from Li et al., 2021

Phenotype of all Fish created by or utilizing MO1-fars2

Phenotype	Fish	Conditions	Figures
whole organism lef1 expression decreased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
whole organism gsk3ba expression decreased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
post-vent region curved, abnormal	AB + MO1-fars2	control	Fig. 7 from Chen et al., 2022
whole organism decreased life span, abnormal	AB + MO1-fars2	standard conditions	Figure 1 from Li et al., 2021
heart decreased functionality, abnormal	AB + MO1-fars2	standard conditions	text only from Li et al., 2024
whole organism dkk1b expression increased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
myotome C-shaped, abnormal	AB + MO1-fars2	control	Fig. 7 from Chen et al., 2022
whole organism axin1 expression decreased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
motor neuron axon decreased length, abnormal	AB + MO1-fars2	control	Fig. 7 from Chen et al., 2022
yolk syncytial layer increased size, abnormal	AB + MO1-fars2	standard conditions	Figure 1 from Li et al., 2021
whole organism notch1b expression increased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
developmental growth delayed, abnormal	AB + MO1-fars2	standard conditions	Figure 1 from Li et al., 2021
pericardium edematous, abnormal	AB + MO1-fars2	standard conditions	Figure 2. from Li et al., 2024
whole organism wnt9a expression decreased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
whole organism viability, abnormal	AB + MO1-fars2	control	Fig. 7 from Chen et al., 2022
whole organism dead, abnormal	AB + MO1-fars2	control	Fig. 7 from Chen et al., 2022
trunk curved, abnormal	AB + MO1-fars2	standard conditions	Figure 1 from Li et al., 2021
whole organism ctnnb1 expression decreased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
whole organism hey2 expression increased amount, abnormal	AB + MO1-fars2	standard conditions	Figure 5 from Li et al., 2021
caudal vein plexus morphology, abnormal	y1Tg + MO1-fars2	standard conditions	Figure 2 from Li et al., 2021
parachordal vessel morphology, abnormal	y1Tg + MO1-fars2	standard conditions	Figure 2 from Li et al., 2021
intersegmental vessel decreased length, abnormal	y1Tg + MO1-fars2	standard conditions	Figure 2 from Li et al., 2021
angiogenic sprout decreased amount, abnormal	y1Tg + MO1-fars2	standard conditions	Figure 2 from Li et al., 2021
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-fars2	standard conditions	Figure 2 from Li et al., 2021

Citations