Morpholino

MO1-cgnb

ID
ZDB-MRPHLNO-221209-3
Name
MO1-cgnb
Previous Names
None
Target
Sequence
5' - TCCTGTCCGCAGAGAGGGAACTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cgnb
Expressed Gene Anatomy Figures
akt2 FIGURE 9 with image from Lu et al., 2022
akt3b FIGURE 9 with image from Lu et al., 2022
atf7b FIGURE 9 with image from Lu et al., 2022
atoh1a FIGURE 5 with image from Lu et al., 2022
eya1 FIGURE 3 with image from Lu et al., 2022
gadd45aa FIGURE 9 with image from Lu et al., 2022
mapk1 FIGURE 9 with image from Lu et al., 2022
mapk3 FIGURE 9 with image from Lu et al., 2022
mapk12b FIGURE 9 with image from Lu et al., 2022
mef2ca FIGURE 9 with image from Lu et al., 2022
ppp3cca FIGURE 9 with image from Lu et al., 2022
ppp3r1a FIGURE 9 with image from Lu et al., 2022
tp53 FIGURE 9 with image from Lu et al., 2022
Phenotype
Phenotype resulting from MO1-cgnb
Phenotype Fish Figures
neuromast cell population proliferation decreased occurrence, abnormal s356tTg + MO1-cgnb FIGURE 5 with image from Lu et al., 2022
neuromast hair cell decreased amount, abnormal s356tTg + MO1-cgnb FIGURE 5 with image from Lu et al., 2022
neuromast hair cell atoh1a expression decreased amount, abnormal s356tTg + MO1-cgnb FIGURE 5 with image from Lu et al., 2022
posterior lateral line primordium cell population proliferation decreased occurrence, abnormal AB + MO1-cgnb FIGURE 4 with image from Lu et al., 2022
trunk neuromast eya1 expression decreased amount, abnormal zf106Tg + MO1-cgnb FIGURE 3 with image from Lu et al., 2022
trunk neuromast decreased amount, abnormal zf106Tg + MO1-cgnb FIGURE 3 with image from Lu et al., 2022
trunk neuromast hair cell decreased amount, abnormal s356tTg + MO1-cgnb FIGURE 5 with image from Lu et al., 2022
whole organism ppp3cca expression decreased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism mapk1 expression decreased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism mapk3 expression decreased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism atf7b expression decreased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism akt2 expression decreased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism akt3b expression decreased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism ppp3r1a expression decreased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism gadd45aa expression increased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism mef2ca expression increased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism tp53 expression increased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
whole organism mapk12b expression increased amount, abnormal AB + MO1-cgnb FIGURE 9 with image from Lu et al., 2022
Phenotype of all Fish created by or utilizing MO1-cgnb
Phenotype Fish Conditions Figures
whole organism tp53 expression increased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism mapk12b expression increased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism akt3b expression decreased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism mapk1 expression decreased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism mapk3 expression decreased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism atf7b expression decreased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism ppp3r1a expression decreased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism ppp3cca expression decreased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism mef2ca expression increased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism akt2 expression decreased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
whole organism gadd45aa expression increased amount, abnormal AB + MO1-cgnb standard conditions FIGURE 9 with image from Lu et al., 2022
posterior lateral line primordium cell population proliferation decreased occurrence, abnormal AB + MO1-cgnb standard conditions FIGURE 4 with image from Lu et al., 2022
trunk neuromast hair cell decreased amount, abnormal s356tTg + MO1-cgnb standard conditions FIGURE 5 with image from Lu et al., 2022
neuromast cell population proliferation decreased occurrence, abnormal s356tTg + MO1-cgnb standard conditions FIGURE 5 with image from Lu et al., 2022
neuromast hair cell atoh1a expression decreased amount, abnormal s356tTg + MO1-cgnb standard conditions FIGURE 5 with image from Lu et al., 2022
neuromast hair cell decreased amount, abnormal s356tTg + MO1-cgnb standard conditions FIGURE 5 with image from Lu et al., 2022
trunk neuromast eya1 expression decreased amount, abnormal zf106Tg + MO1-cgnb standard conditions FIGURE 3 with image from Lu et al., 2022
trunk neuromast decreased amount, abnormal zf106Tg + MO1-cgnb standard conditions FIGURE 3 with image from Lu et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.