Morpholino

MO1-mir26a

ID
ZDB-MRPHLNO-200609-1
Name
MO1-mir26a
Previous Names
None
Targets
Sequence
5' - AGCCTATCCTGGATTACTTGAAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir26a
Expressed Gene Anatomy Figures
acta2 Fig 5 with image,  Fig. S5 from Watterston et al., 2019
myh11a Fig 5 with image,  Fig. S5 from Watterston et al., 2019
notch3 Fig 5 with image from Watterston et al., 2019
pdgfba Fig 5 with image from Watterston et al., 2019
pdgfrb Fig 5 with image from Watterston et al., 2019
smad1 Fig 2 with image,  Fig. S4 from Watterston et al., 2019
Phenotype
Phenotype resulting from MO1-mir26a
No data available
Phenotype of all Fish created by or utilizing MO1-mir26a
Phenotype Fish Conditions Figures
whole organism smad1 expression increased amount, abnormal WT + MO1-mir26a control Fig 2 with image from Watterston et al., 2019
head myh11a expression increased amount, abnormal WT + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
head notch3 expression increased amount, abnormal WT + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
pharyngeal arch ventral region smad1 expression increased amount, abnormal WT + MO1-mir26a control Fig 2 with image from Watterston et al., 2019
head acta2 expression increased amount, abnormal WT + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
head pdgfrb expression increased amount, abnormal WT + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
ventral aorta smad1 expression increased amount, abnormal WT + MO1-mir26a control Fig 2 with image from Watterston et al., 2019
aortic arch smad1 expression increased amount, abnormal WT + MO1-mir26a control Fig 2 with image from Watterston et al., 2019
head smad1 expression increased amount, abnormal WT + MO1-mir26a control Fig 2 with image,  Fig. S4 from Watterston et al., 2019
head hemorrhagic, abnormal WT + MO1-mir26a control Fig 4 with image,  Fig. S4 from Watterston et al., 2019
pharyngeal arch ventral region myh11a expression increased amount, abnormal WT + MO1-mir26a control Fig. S5 from Watterston et al., 2019
head pdgfba expression increased amount, abnormal WT + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
pharyngeal arch ventral region acta2 expression increased amount, abnormal WT + MO1-mir26a control Fig. S5 from Watterston et al., 2019
whole organism ventralized, ameliorated WT + MO1-mir26a + MO1-smad1 control Fig 4 with image from Watterston et al., 2019
head hemorrhagic, ameliorated WT + MO1-mir26a + MO1-smad1 control Fig 4 with image from Watterston et al., 2019
ventral aorta endothelial cell decreased amount, ameliorated y7Tg + MO1-mir26a chemical treatment by environment: inhibitor Fig 6 with image from Watterston et al., 2019
ventral aorta vascular smooth muscle amount, ameliorated ca7Tg; ci5Tg + MO1-mir26a chemical treatment by environment: inhibitor Fig 6 with image from Watterston et al., 2019
ventral aorta length, ameliorated ca7Tg; ci5Tg + MO1-mir26a chemical treatment by environment: inhibitor Fig 6 with image from Watterston et al., 2019
aortic arch vascular smooth muscle amount, ameliorated ca7Tg; ci5Tg + MO1-mir26a chemical treatment by environment: inhibitor Fig 6 with image from Watterston et al., 2019
ventral aorta vascular smooth muscle decreased height, abnormal ca8Tg; mw29Tg + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
ventral aorta vascular smooth muscle increased amount, abnormal ca8Tg; mw29Tg + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
aortic arch EGFP expression increased amount, abnormal ca8Tg; mw29Tg + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
aortic arch vascular smooth muscle increased amount, abnormal ca8Tg; mw29Tg + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
aortic arch vascular smooth muscle decreased height, abnormal ca8Tg; mw29Tg + MO1-mir26a control Fig 5 with image from Watterston et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.