Morpholino

MO1-hars

ID

ZDB-MRPHLNO-191104-1

Name

MO1-hars

Previous Names

None

Target

hars (1)

Sequence

5' - ATGGTGCTCCAGAAACACAGCCGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hars

Expressed Gene	Anatomy	Figures
asns	head whole organism	FIGURE 5 from Waldron et al., 2019
eif4ebp1	head whole organism	FIGURE 5 from Waldron et al., 2019
gpt2	head	FIGURE 5 from Waldron et al., 2019

Phenotype

Phenotype resulting from MO1-hars

Phenotype	Fish	Figures
eye decreased diameter, abnormal	TL + MO1-hars + MO4-tp53	FIGURE 2 from Waldron et al., 2019
head decreased size, abnormal	TL + MO1-hars	FIGURE 2 from Waldron et al., 2019
head eif4ebp1 expression increased amount, abnormal	TL + MO1-hars	FIGURE 5 from Waldron et al., 2019
head gpt2 expression increased amount, abnormal	TL + MO1-hars	FIGURE 5 from Waldron et al., 2019
head asns expression increased amount, abnormal	TL + MO1-hars	FIGURE 5 from Waldron et al., 2019
lateral line neuromast hair cell decreased amount, abnormal	s356tTg + MO1-hars	FIGURE 7 from Waldron et al., 2019
motor neuron axon branchiness, abnormal	sb2Tg; zf3031Tg + MO1-hars	FIGURE 7 from Waldron et al., 2019
optic cup Ab16-casp3 labeling increased amount, abnormal	TL + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic cup Ab16-casp3 labeling increased distribution, abnormal	TL + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic cup apoptotic process increased occurrence, abnormal	TL + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic vesicle Ab36-h3 labeling decreased amount, abnormal	zf460Tg + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic vesicle Ab36-h3 labeling decreased distribution, abnormal	zf460Tg + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic vesicle Ab16-casp3 labeling increased amount, abnormal	zf460Tg + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic vesicle Ab16-casp3 labeling increased distribution, abnormal	zf460Tg + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic vesicle apoptotic process increased occurrence, abnormal	zf460Tg + MO1-hars	FIGURE 4 from Waldron et al., 2019
optic vesicle cell population proliferation decreased occurrence, abnormal	zf460Tg + MO1-hars	FIGURE 4 from Waldron et al., 2019
retina cell decreased amount, abnormal	TL + MO1-hars	FIGURE 3 from Waldron et al., 2019
sensory neuron axon branchiness, abnormal	sb2Tg; zf3031Tg + MO1-hars	FIGURE 7 from Waldron et al., 2019
whole organism decreased length, abnormal	TL + MO1-hars	FIGURE 2 from Waldron et al., 2019
whole organism asns expression increased amount, abnormal	TL + MO1-hars	FIGURE 5 from Waldron et al., 2019
whole organism eif4ebp1 expression increased amount, abnormal	TL + MO1-hars	FIGURE 5 from Waldron et al., 2019

Phenotype of all Fish created by or utilizing MO1-hars

Phenotype	Fish	Conditions	Figures
optic cup Ab16-casp3 labeling increased distribution, abnormal	TL + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
whole organism decreased length, abnormal	TL + MO1-hars	control	FIGURE 2 from Waldron et al., 2019
head decreased size, abnormal	TL + MO1-hars	control	FIGURE 2 from Waldron et al., 2019
head eif4ebp1 expression increased amount, abnormal	TL + MO1-hars	control	FIGURE 5 from Waldron et al., 2019
head gpt2 expression increased amount, abnormal	TL + MO1-hars	control	FIGURE 5 from Waldron et al., 2019
whole organism asns expression increased amount, abnormal	TL + MO1-hars	control	FIGURE 5 from Waldron et al., 2019
whole organism eif4ebp1 expression increased amount, abnormal	TL + MO1-hars	control	FIGURE 5 from Waldron et al., 2019
optic cup Ab16-casp3 labeling increased amount, abnormal	TL + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
head asns expression increased amount, abnormal	TL + MO1-hars	control	FIGURE 5 from Waldron et al., 2019
optic cup apoptotic process increased occurrence, abnormal	TL + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
retina cell decreased amount, abnormal	TL + MO1-hars	control	FIGURE 3 from Waldron et al., 2019
eye decreased diameter, abnormal	TL + MO1-hars	control	FIGURE 2 from Waldron et al., 2019
eye decreased diameter, abnormal	TL + MO1-hars + MO4-tp53	control	FIGURE 2 from Waldron et al., 2019
lateral line neuromast hair cell decreased amount, abnormal	s356tTg + MO1-hars	control	FIGURE 7 from Waldron et al., 2019
optic vesicle Ab36-h3 labeling decreased amount, abnormal	zf460Tg + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
optic vesicle apoptotic process increased occurrence, abnormal	zf460Tg + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
optic vesicle Ab36-h3 labeling decreased distribution, abnormal	zf460Tg + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
optic vesicle Ab16-casp3 labeling increased distribution, abnormal	zf460Tg + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
optic vesicle cell population proliferation decreased occurrence, abnormal	zf460Tg + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
optic vesicle Ab16-casp3 labeling increased amount, abnormal	zf460Tg + MO1-hars	control	FIGURE 4 from Waldron et al., 2019
sensory neuron axon branchiness, abnormal	sb2Tg; zf3031Tg + MO1-hars	control	FIGURE 7 from Waldron et al., 2019
motor neuron axon branchiness, abnormal	sb2Tg; zf3031Tg + MO1-hars	control	FIGURE 7 from Waldron et al., 2019

Citations