Morpholino

MO3-ifnlr1

ID
ZDB-MRPHLNO-180913-1
Name
MO3-ifnlr1
Previous Names
  • ifnlr1-e4i4-MO (1)
Target
Sequence
5' - AGAGATGATACTAACCTGTGATCCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ifnlr1
Expressed Gene Anatomy Figures
crfb4 Fig. 5 from Gao et al., 2018
irf9 Fig. 5 from Gao et al., 2018
jak1 Fig. 5 from Gao et al., 2018
stat1a Fig. 5 from Gao et al., 2018
stat2 Fig. 5 from Gao et al., 2018
stat3 Fig. 5 from Gao et al., 2018
stat4 Fig. 5 from Gao et al., 2018
stat5a Fig. 6 with image from Wang et al., 2021
stat5b Fig. 6 with image from Wang et al., 2021
Fig. 5 from Gao et al., 2018
tyk2 Fig. 5 from Gao et al., 2018
Phenotype
Phenotype resulting from MO3-ifnlr1
Phenotype Fish Figures
cell surface receptor signaling pathway via JAK-STAT increased occurrence, abnormal AB + MO3-ifnlr1 Fig. 5 from Gao et al., 2018
intestine lumen distended, abnormal AB + MO3-ifnlr1 Fig. 3 with image from Gao et al., 2018
neuromast decreased amount, abnormal s356tTg + MO3-ifnlr1 Fig. 1 with image from Wang et al., 2021
Fig. 3 with image,  Fig. 4 with image from Gao et al., 2018
neuromast cell population proliferation decreased occurrence, abnormal s356tTg + MO3-ifnlr1 Fig. 3 with image from Gao et al., 2018
neuromast hair cell decreased amount, abnormal s356tTg + MO3-ifnlr1 Fig. 3 with image,  Fig. 4 with image from Gao et al., 2018
neuromast support cell decreased amount, abnormal s356tTg + MO3-ifnlr1 Fig. 3 with image from Gao et al., 2018
swim bladder uninflated, abnormal AB + MO3-ifnlr1 Fig. 1 with image from Wang et al., 2021
Fig. 3 with image,  Fig. 4 with image from Gao et al., 2018
whole organism stat5a expression decreased amount, abnormal AB + MO3-ifnlr1 Fig. 6 with image from Wang et al., 2021
whole organism crfb4 expression increased amount, abnormal AB + MO3-ifnlr1 Fig. 5 from Gao et al., 2018
whole organism jak1 expression increased amount, abnormal AB + MO3-ifnlr1 Fig. 5 from Gao et al., 2018
whole organism stat5b expression increased amount, abnormal AB + MO3-ifnlr1 Fig. 5 from Gao et al., 2018
whole organism tyk2 expression increased amount, abnormal AB + MO3-ifnlr1 Fig. 5 from Gao et al., 2018
whole organism stat3 expression increased amount, abnormal AB + MO3-ifnlr1 Fig. 5 from Gao et al., 2018
Phenotype of all Fish created by or utilizing MO3-ifnlr1
Phenotype Fish Conditions Figures
whole organism crfb4 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
neuromast hair cell decreased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 3 with image,  Fig. 4 with image from Gao et al., 2018
intestine lumen distended, abnormal AB + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast decreased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 1 with image from Wang et al., 2021
Fig. 3 with image,  Fig. 4 with image from Gao et al., 2018
whole organism stat3 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
whole organism tyk2 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
swim bladder uninflated, abnormal AB + MO3-ifnlr1 standard conditions Fig. 1 with image from Wang et al., 2021
Fig. 3 with image,  Fig. 4 with image from Gao et al., 2018
whole organism stat5b expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
whole organism jak1 expression increased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
whole organism stat5a expression decreased amount, abnormal AB + MO3-ifnlr1 standard conditions Fig. 6 with image from Wang et al., 2021
cell surface receptor signaling pathway via JAK-STAT increased occurrence, abnormal AB + MO3-ifnlr1 standard conditions Fig. 5 from Gao et al., 2018
neuromast cell population proliferation decreased occurrence, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast support cell decreased amount, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast decreased amount, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
neuromast hair cell decreased amount, abnormal s356tTg + MO3-ifnlr1 standard conditions Fig. 3 with image from Gao et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.