Morpholino

MO1-adamts16

ID

ZDB-MRPHLNO-180831-1

Name

MO1-adamts16

Previous Names

None

Target

Sequence

5' - AGCTCGTAAGACAGCCATGTCTCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-adamts16

Expressed Gene	Anatomy	Figures
aldh1a2	retina	Fig. 5 from Cao et al., 2018
aldh1a3	retina	Fig. 5 from Cao et al., 2018
fgf8a	midbrain hindbrain boundary retina	Fig. 5 from Cao et al., 2018
foxc1a	optic furrow	Fig. 5 from Cao et al., 2018
pax2a	optic furrow	Fig. 5 from Cao et al., 2018
tbx5a	retina	Fig. 5 from Cao et al., 2018
vax2	retina	Fig. 5 from Cao et al., 2018

Phenotype

Phenotype resulting from MO1-adamts16

Phenotype	Fish	Figures
basement membrane disassembly disrupted, abnormal	AB + MO1-adamts16	Fig. 3 from Cao et al., 2018
closure of optic fissure disrupted, abnormal	AB + MO1-adamts16	Fig. 2 from Cao et al., 2018
eye decreased area, abnormal	AB + MO1-adamts16	Fig. 2 from Cao et al., 2018
eye decreased size, abnormal	AB + MO1-adamts16	Fig. 2 from Cao et al., 2018
optic cup apoptotic process increased occurrence, abnormal	AB + MO1-adamts16	Fig. 4 from Cao et al., 2018
optic cup basement membrane morphology, abnormal	AB + MO1-adamts16	Fig. 3 from Cao et al., 2018
optic cup cell population proliferation decreased rate, abnormal	AB + MO1-adamts16	Fig. 4 from Cao et al., 2018
retina fgf8a expression increased amount, abnormal	AB + MO1-adamts16	Fig. 5 from Cao et al., 2018
retina perforate, abnormal	AB + MO1-adamts16	Fig. 2 from Cao et al., 2018

Phenotype of all Fish created by or utilizing MO1-adamts16

Phenotype	Fish	Conditions	Figures
retina fgf8a expression increased amount, abnormal	AB + MO1-adamts16	standard conditions	Fig. 5 from Cao et al., 2018
retina perforate, abnormal	AB + MO1-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
optic cup cell population proliferation decreased rate, abnormal	AB + MO1-adamts16	standard conditions	Fig. 4 from Cao et al., 2018
closure of optic fissure disrupted, abnormal	AB + MO1-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
eye decreased area, abnormal	AB + MO1-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
eye decreased size, abnormal	AB + MO1-adamts16	standard conditions	Fig. 2 from Cao et al., 2018
optic cup basement membrane morphology, abnormal	AB + MO1-adamts16	standard conditions	Fig. 3 from Cao et al., 2018
optic cup apoptotic process increased occurrence, abnormal	AB + MO1-adamts16	standard conditions	Fig. 4 from Cao et al., 2018
basement membrane disassembly disrupted, abnormal	AB + MO1-adamts16	standard conditions	Fig. 3 from Cao et al., 2018
closure of optic fissure process quality, ameliorated	AB + MO1-adamts16 + MO3-fgf8a	standard conditions	Fig. 5 from Cao et al., 2018

Citations