Morpholino

MO2-rpl22l1

ID

ZDB-MRPHLNO-180411-1

Name

MO2-rpl22l1

Previous Names

None

Target

rpl22l1 (1)

Sequence

5' - AACAGTCTGCCTTTTCGGTGCCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-rpl22l1

Expressed Gene	Anatomy	Figures
lft1	(not) mesoderm	Fig. 1 from Zhang et al., 2017
sox32	endoderm	Fig. 1 from Zhang et al., 2017
tbxta	notochord	Fig. 1 from Zhang et al., 2017

Phenotype

Phenotype resulting from MO2-rpl22l1

Phenotype	Fish	Figures
convergent extension involved in axis elongation decreased occurrence, abnormal	WT + MO2-rpl22l1	Fig. 1 , Fig. 3 from Zhang et al., 2017
endoderm sox32 expression decreased distribution, abnormal	WT + MO2-rpl22l1	Fig. 1 from Zhang et al., 2017
mesoderm lft1 expression absent, abnormal	WT + MO2-rpl22l1	Fig. 1 from Zhang et al., 2017
mRNA cis splicing, via spliceosome process quality, abnormal	WT + MO2-rpl22l1	Fig. 2, Fig. 7 from Zhang et al., 2017
notochord decreased length, abnormal	WT + MO2-rpl22l1	Fig. 1 , Fig. 3 from Zhang et al., 2017
notochord increased width, abnormal	WT + MO2-rpl22l1	Fig. 1 , Fig. 3 from Zhang et al., 2017
notochord tbxta expression spatial pattern, abnormal	WT + MO2-rpl22l1	Fig. 1 from Zhang et al., 2017
whole organism ab-smad2 labeling decreased amount, abnormal	WT + MO2-rpl22l1	Fig. 1 from Zhang et al., 2017

Phenotype of all Fish created by or utilizing MO2-rpl22l1

Phenotype	Fish	Conditions	Figures
convergent extension involved in axis elongation decreased occurrence, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 1 , Fig. 3 from Zhang et al., 2017
endoderm sox32 expression decreased distribution, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 1 from Zhang et al., 2017
mRNA cis splicing, via spliceosome process quality, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 2, Fig. 7 from Zhang et al., 2017
notochord tbxta expression spatial pattern, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 1 from Zhang et al., 2017
notochord decreased length, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 1 , Fig. 3 from Zhang et al., 2017
notochord increased width, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 1 , Fig. 3 from Zhang et al., 2017
mesoderm lft1 expression absent, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 1 from Zhang et al., 2017
whole organism ab-smad2 labeling decreased amount, abnormal	WT + MO2-rpl22l1	standard conditions	Fig. 1 from Zhang et al., 2017
mRNA cis splicing, via spliceosome process quality, ameliorated	WT + MO1-hnrnpa1b + MO2-rpl22l1	standard conditions	Fig. 7 from Zhang et al., 2017
mRNA cis splicing, via spliceosome process quality, ameliorated	WT + MO1-rpl22 + MO2-rpl22l1	standard conditions	Fig. 2, Fig. 7 from Zhang et al., 2017
convergent extension involved in axis elongation occurrence, ameliorated	WT + MO1-rpl22 + MO2-rpl22l1	standard conditions	Fig. 1 from Zhang et al., 2017
mRNA cis splicing, via spliceosome process quality, ameliorated	WT + MO1-hnrnpa1b + MO1-rpl22 + MO2-rpl22l1	standard conditions	Fig. 7 from Zhang et al., 2017

Citations