Morpholino

MO1-cacng2a

ID

ZDB-MRPHLNO-160526-17

Name

MO1-cacng2a

Previous Names

None

Target

cacng2a (1)

Sequence

5' - GGCATAACAGTCGCCTTACCTTCCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cacng2a

No data available

Phenotype

Phenotype resulting from MO1-cacng2a

Phenotype	Fish	Figures
heart edematous, abnormal	AB + MO1-cacng2a	Fig. 3 from Roy et al., 2016
hindbrain Ab1-gria2,3 labeling decreased amount, abnormal	AB + MO1-cacng2a	Fig. 10 from Roy et al., 2016
hindbrain AMPA glutamate receptor clustering decreased occurrence, abnormal	AB + MO1-cacng2a	Fig. 10 from Roy et al., 2016
Mauthner neuron has fewer parts of type Mauthner neuron AMPA glutamate receptor complex, abnormal	AB + MO1-cacng2a	Fig. 8 from Roy et al., 2016
Mauthner neuron AMPA selective glutamate receptor signaling pathway decreased magnitude, abnormal	AB + MO1-cacng2a	Fig. 6 from Roy et al., 2016
Mauthner neuron AMPA selective glutamate receptor signaling pathway decreased rate, abnormal	AB + MO1-cacng2a	Fig. 6 from Roy et al., 2016
startle response decreased process quality, abnormal	AB + MO1-cacng2a	Fig. 4 , Fig. 5 from Roy et al., 2016
thigmotaxis decreased process quality, abnormal	AB + MO1-cacng2a	Fig. 4 , Fig. 5 from Roy et al., 2016

Phenotype of all Fish created by or utilizing MO1-cacng2a

Phenotype	Fish	Conditions	Figures
startle response decreased process quality, abnormal	AB + MO1-cacng2a	standard conditions	Fig. 4 , Fig. 5 from Roy et al., 2016
Mauthner neuron AMPA selective glutamate receptor signaling pathway decreased rate, abnormal	AB + MO1-cacng2a	standard conditions	Fig. 6 from Roy et al., 2016
hindbrain Ab1-gria2,3 labeling decreased amount, abnormal	AB + MO1-cacng2a	control	Fig. 10 from Roy et al., 2016
Mauthner neuron AMPA selective glutamate receptor signaling pathway decreased magnitude, abnormal	AB + MO1-cacng2a	standard conditions	Fig. 6 from Roy et al., 2016
thigmotaxis decreased process quality, abnormal	AB + MO1-cacng2a	standard conditions	Fig. 4 , Fig. 5 from Roy et al., 2016
Mauthner neuron has fewer parts of type Mauthner neuron AMPA glutamate receptor complex, abnormal	AB + MO1-cacng2a	standard conditions	Fig. 8 from Roy et al., 2016
hindbrain AMPA glutamate receptor clustering decreased occurrence, abnormal	AB + MO1-cacng2a	control	Fig. 10 from Roy et al., 2016
heart edematous, abnormal	AB + MO1-cacng2a	standard conditions	Fig. 3 from Roy et al., 2016
Mauthner neuron AMPA selective glutamate receptor signaling pathway decreased rate, abnormal	AB + MO1-cacng2a + MO1-cacng2b	standard conditions	Fig. 6 from Roy et al., 2016
Mauthner neuron AMPA selective glutamate receptor signaling pathway decreased magnitude, abnormal	AB + MO1-cacng2a + MO1-cacng2b	standard conditions	Fig. 6 from Roy et al., 2016
startle response decreased process quality, abnormal	AB + MO1-cacng2a + MO1-cacng2b	standard conditions	Fig. 4 , Fig. 5 from Roy et al., 2016
post-vent region curved dorsal, abnormal	AB + MO1-cacng2a + MO1-cacng2b	standard conditions	Fig. 3 from Roy et al., 2016
thigmotaxis decreased process quality, abnormal	AB + MO1-cacng2a + MO1-cacng2b	standard conditions	Fig. 4 , Fig. 5 from Roy et al., 2016
heart edematous, abnormal	AB + MO1-cacng2a + MO1-cacng2b	standard conditions	Fig. 3 from Roy et al., 2016

Citations