Morpholino

MO1-aclya

ID

ZDB-MRPHLNO-160107-5

Name

MO1-aclya

Previous Names

None

Target

Sequence

5' - CTGACATGATGGAGCTGGAGGACTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-aclya

Expressed Gene	Anatomy	Figures
chata	motor neuron neuronal cell body spinal cord	Fig. 7 from Sun et al., 2015
chrna1	myotome neuromuscular junction	Fig. 7 from Sun et al., 2015
syt2b	motor neuron axon spinal cord motor neuron	Fig. 6 from Sun et al., 2015

Phenotype

Phenotype resulting from MO1-aclya

Phenotype	Fish	Figures
motor neuron axon decreased length, abnormal	WT + MO1-aclya	Fig. 6 from Sun et al., 2015
motor neuron neuronal cell body chata expression mislocalised, abnormal	ns10Tg + MO1-aclya	Fig. 7 from Sun et al., 2015
myotome acetylcholine-gated channel complex increased area, abnormal	WT + MO1-aclya	Fig. 7 from Sun et al., 2015
myotome acetylcholine-gated channel complex chrna1 expression increased distribution, abnormal	WT + MO1-aclya	Fig. 7 from Sun et al., 2015
myotome neuromuscular junction of skeletal muscle fiber area, abnormal	WT + MO1-aclya	Fig. 7 from Sun et al., 2015
myotome regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-aclya	Fig. 7 from Sun et al., 2015
regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-aclya	Fig. 7 from Sun et al., 2015
spinal cord motor neuron axon guidance decreased process quality, abnormal	WT + MO1-aclya	Fig. 6 from Sun et al., 2015
thigmotaxis decreased occurrence, abnormal	WT + MO1-aclya	Fig. 7 , Fig. S7 from Sun et al., 2015

Phenotype of all Fish created by or utilizing MO1-aclya

Phenotype	Fish	Conditions	Figures
spinal cord motor neuron axon guidance decreased process quality, abnormal	WT + MO1-aclya	standard conditions	Fig. 6 from Sun et al., 2015
myotome acetylcholine-gated channel complex chrna1 expression increased distribution, abnormal	WT + MO1-aclya	standard conditions	Fig. 7 from Sun et al., 2015
thigmotaxis decreased occurrence, abnormal	WT + MO1-aclya	standard conditions	Fig. 7 , Fig. S7 from Sun et al., 2015
regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-aclya	standard conditions	Fig. 7 from Sun et al., 2015
myotome regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-aclya	standard conditions	Fig. 7 from Sun et al., 2015
motor neuron axon decreased length, abnormal	WT + MO1-aclya	standard conditions	Fig. 6 from Sun et al., 2015
myotome neuromuscular junction of skeletal muscle fiber area, abnormal	WT + MO1-aclya	standard conditions	Fig. 7 from Sun et al., 2015
myotome acetylcholine-gated channel complex increased area, abnormal	WT + MO1-aclya	standard conditions	Fig. 7 from Sun et al., 2015
motor neuron neuronal cell body chata expression mislocalised, abnormal	ns10Tg + MO1-aclya	standard conditions	Fig. 7 from Sun et al., 2015

Citations