Morpholino

MO1-atcaya

ID

ZDB-MRPHLNO-160107-3

Name

MO1-atcaya

Previous Names

Target

Sequence

5' - CACAGGAAGAGTCCATGTCACCCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to ATG start codon

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-atcaya

Expressed Gene	Anatomy	Figures
chata	motor neuron neuronal cell body spinal cord	Fig. 7 from Sun et al., 2015
chrna1	myotome acetylcholine-gated channel complex	Fig. 7 from Sun et al., 2015
syt2b	motor neuron axon spinal cord motor neuron	Fig. 6 from Sun et al., 2015

Phenotype

Phenotype resulting from MO1-atcaya

Phenotype	Fish	Figures
locomotion involved in locomotory behavior decreased occurrence, abnormal	WT + MO1-atcaya	Fig. S7 from Sun et al., 2015
motor neuron axon decreased length, abnormal	WT + MO1-atcaya	Fig. 6 from Sun et al., 2015
motor neuron neuronal cell body chata expression mislocalised, abnormal	ns10Tg + MO1-atcaya	Fig. 7 from Sun et al., 2015
myotome malformed, abnormal	WT + MO1-atcaya	Fig. S7 from Sun et al., 2015
myotome acetylcholine-gated channel complex increased area, abnormal	WT + MO1-atcaya	Fig. 7 from Sun et al., 2015
myotome acetylcholine-gated channel complex chrna1 expression increased distribution, abnormal	WT + MO1-atcaya	Fig. 7 from Sun et al., 2015
myotome neuromuscular junction of skeletal muscle fiber area, abnormal	WT + MO1-atcaya	Fig. 7 from Sun et al., 2015
myotome regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-atcaya	Fig. 7 from Sun et al., 2015
regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-atcaya	Fig. 7 from Sun et al., 2015
spinal cord motor neuron axon guidance decreased process quality, abnormal	WT + MO1-atcaya	Fig. 6 from Sun et al., 2015
thigmotaxis decreased occurrence, abnormal	WT + MO1-atcaya	Fig. 7 , Fig. S7 from Sun et al., 2015

Phenotype of all Fish created by or utilizing MO1-atcaya

Phenotype	Fish	Conditions	Figures
myotome regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-atcaya	standard conditions	Fig. 7 from Sun et al., 2015
myotome acetylcholine-gated channel complex chrna1 expression increased distribution, abnormal	WT + MO1-atcaya	standard conditions	Fig. 7 from Sun et al., 2015
spinal cord motor neuron axon guidance decreased process quality, abnormal	WT + MO1-atcaya	standard conditions	Fig. 6 from Sun et al., 2015
thigmotaxis decreased occurrence, abnormal	WT + MO1-atcaya	standard conditions	Fig. 7 , Fig. S7 from Sun et al., 2015
regulation of synaptic transmission, cholinergic decreased process quality, abnormal	WT + MO1-atcaya	standard conditions	Fig. 7 from Sun et al., 2015
motor neuron axon decreased length, abnormal	WT + MO1-atcaya	standard conditions	Fig. 6 from Sun et al., 2015
myotome neuromuscular junction of skeletal muscle fiber area, abnormal	WT + MO1-atcaya	standard conditions	Fig. 7 from Sun et al., 2015
locomotion involved in locomotory behavior decreased occurrence, abnormal	WT + MO1-atcaya	standard conditions	Fig. S7 from Sun et al., 2015
myotome malformed, abnormal	WT + MO1-atcaya	standard conditions	Fig. S7 from Sun et al., 2015
myotome acetylcholine-gated channel complex increased area, abnormal	WT + MO1-atcaya	standard conditions	Fig. 7 from Sun et al., 2015
motor neuron neuronal cell body chata expression mislocalised, abnormal	ns10Tg + MO1-atcaya	standard conditions	Fig. 7 from Sun et al., 2015

Citations