Morpholino

MO2-pmela

ID

ZDB-MRPHLNO-150618-3

Name

MO2-pmela

Previous Names

None

Target

pmela (1)

Sequence

5' - GATGAGAGATGTCCACATGATGACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-pmela

No data available

Phenotype

Phenotype resulting from MO2-pmela

Phenotype	Fish	Figures
eye decreased pigmentation, abnormal	AB + MO2-pmela	Fig. S5 from Lahola-Chomiak et al., 2018
melanosome assembly process quality, abnormal	WT + MO2-pmela	Fig. 5 , Fig. 6 from Burgoyne et al., 2015
melanosome localization process quality, abnormal	WT + MO2-pmela	Fig. 6 from Burgoyne et al., 2015
photoreceptor cell photoreceptor outer segment morphology, abnormal	WT + MO2-pmela	Fig. 6 from Burgoyne et al., 2015
photoreceptor cell photoreceptor outer segment structure, abnormal	WT + MO2-pmela	Fig. 6 from Burgoyne et al., 2015
retinal pigmented epithelium melanosome decreased amount, abnormal	WT + MO2-pmela	Fig. 5 from Burgoyne et al., 2015
retinal pigmented epithelium melanosome morphology, abnormal	WT + MO2-pmela	Fig. 5 , Fig. 6 from Burgoyne et al., 2015

Phenotype of all Fish created by or utilizing MO2-pmela

Phenotype	Fish	Conditions	Figures
eye decreased pigmentation, abnormal	AB + MO2-pmela	standard conditions	Fig. S5 from Lahola-Chomiak et al., 2018
photoreceptor cell photoreceptor outer segment morphology, abnormal	WT + MO2-pmela	standard conditions	Fig. 6 from Burgoyne et al., 2015
photoreceptor cell photoreceptor outer segment structure, abnormal	WT + MO2-pmela	standard conditions	Fig. 6 from Burgoyne et al., 2015
melanosome localization process quality, abnormal	WT + MO2-pmela	standard conditions	Fig. 6 from Burgoyne et al., 2015
melanosome assembly process quality, abnormal	WT + MO2-pmela	standard conditions	Fig. 5 , Fig. 6 from Burgoyne et al., 2015
retinal pigmented epithelium melanosome decreased amount, abnormal	WT + MO2-pmela	standard conditions	Fig. 5 from Burgoyne et al., 2015
retinal pigmented epithelium melanosome morphology, abnormal	WT + MO2-pmela	standard conditions	Fig. 5 , Fig. 6 from Burgoyne et al., 2015
eye decreased pigmentation, abnormal	AB + MO2-pmela + MO2-pmelb	standard conditions	Fig. S5 from Lahola-Chomiak et al., 2018
melanosome localization process quality, abnormal	WT + MO1-pmelb + MO2-pmela	standard conditions	Fig. 6 from Burgoyne et al., 2015
photoreceptor cell photoreceptor outer segment structure, abnormal	WT + MO1-pmelb + MO2-pmela	standard conditions	Fig. 6 from Burgoyne et al., 2015
retinal pigmented epithelium melanosome decreased amount, abnormal	WT + MO1-pmelb + MO2-pmela	standard conditions	Fig. 5 from Burgoyne et al., 2015
photoreceptor cell photoreceptor outer segment morphology, abnormal	WT + MO1-pmelb + MO2-pmela	standard conditions	Fig. 6 from Burgoyne et al., 2015
melanosome assembly process quality, abnormal	WT + MO1-pmelb + MO2-pmela	standard conditions	Fig. 5 , Fig. 6 from Burgoyne et al., 2015
retinal pigmented epithelium melanosome morphology, abnormal	WT + MO1-pmelb + MO2-pmela	standard conditions	Fig. 5 , Fig. 6 from Burgoyne et al., 2015

Citations