Morpholino

MO1-sar1b

ID
ZDB-MRPHLNO-150415-2
Name
MO1-sar1b
Previous Names
None
Target
Sequence
5' - CAGTCCAACGGGGATCAATGAGGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sar1b
Expressed Gene Anatomy Figures
col2a1a Fig. 5 from Levic et al., 2015
cp Fig. 3 from Levic et al., 2015
dlx2a Fig. 5 from Levic et al., 2015
foxa3 Fig. 3 from Levic et al., 2015
neurod1 Fig. 4 from Levic et al., 2015
nkx2.2a Fig. 3 from Levic et al., 2015
pax6b Fig. 3 from Levic et al., 2015
prox1a Fig. 3 from Levic et al., 2015
prss1 Fig. 3 from Levic et al., 2015
sox9a Fig. 5 from Levic et al., 2015
Phenotype
Phenotype resulting from MO1-sar1b
Phenotype Fish Figures
ceratohyal cartilage malformed, abnormal AB + MO1-sar1b Fig. 5 from Levic et al., 2015
head anterior-posterior axis decreased length, abnormal AB + MO1-sar1b Fig. 5 from Levic et al., 2015
liver decreased size, abnormal gz15Tg + MO1-sar1b Fig. 3 from Levic et al., 2015
liver organ growth decreased process quality, abnormal gz15Tg + MO1-sar1b Fig. 3 from Levic et al., 2015
mandibular arch skeleton malformed, abnormal AB + MO1-sar1b Fig. 1 from Levic et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO1-sar1b Fig. 5 from Levic et al., 2015
optic tectum white matter decreased size, abnormal AB + MO1-sar1b Fig. 4 from Levic et al., 2015
optic tectum white matter position, abnormal AB + MO1-sar1b Fig. 4 from Levic et al., 2015
pancreas decreased size, abnormal gz15Tg + MO1-sar1b Fig. 3 from Levic et al., 2015
pancreas organ growth decreased process quality, abnormal gz15Tg + MO1-sar1b Fig. 3 from Levic et al., 2015
pectoral fin kinked, abnormal AB + MO1-sar1b Fig. 1,  Fig. 5 from Levic et al., 2015
rhombic lip white matter decreased size, abnormal AB + MO1-sar1b Fig. 4 from Levic et al., 2015
rhombic lip white matter position, abnormal AB + MO1-sar1b Fig. 4 from Levic et al., 2015
whole organism decreased length, abnormal AB + MO1-sar1b Fig. 1,  Fig. 5 from Levic et al., 2015
Phenotype of all Fish created by or utilizing MO1-sar1b
Phenotype Fish Conditions Figures
ceratohyal cartilage malformed, abnormal AB + MO1-sar1b standard conditions Fig. 5 from Levic et al., 2015
pectoral fin kinked, abnormal AB + MO1-sar1b standard conditions Fig. 1,  Fig. 5 from Levic et al., 2015
rhombic lip white matter position, abnormal AB + MO1-sar1b standard conditions Fig. 4 from Levic et al., 2015
optic tectum white matter decreased size, abnormal AB + MO1-sar1b standard conditions Fig. 4 from Levic et al., 2015
mandibular arch skeleton malformed, abnormal AB + MO1-sar1b standard conditions Fig. 1 from Levic et al., 2015
pancreas decreased size, abnormal AB + MO1-sar1b standard conditions Fig. 3 from Levic et al., 2015
head anterior-posterior axis decreased length, abnormal AB + MO1-sar1b standard conditions Fig. 5 from Levic et al., 2015
rhombic lip white matter decreased size, abnormal AB + MO1-sar1b standard conditions Fig. 4 from Levic et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO1-sar1b standard conditions Fig. 5 from Levic et al., 2015
optic tectum white matter position, abnormal AB + MO1-sar1b standard conditions Fig. 4 from Levic et al., 2015
whole organism decreased length, abnormal AB + MO1-sar1b standard conditions Fig. 1,  Fig. 5 from Levic et al., 2015
liver decreased size, abnormal gz15Tg + MO1-sar1b standard conditions Fig. 3 from Levic et al., 2015
liver organ growth decreased process quality, abnormal gz15Tg + MO1-sar1b standard conditions Fig. 3 from Levic et al., 2015
pancreas decreased size, abnormal gz15Tg + MO1-sar1b standard conditions Fig. 3 from Levic et al., 2015
pancreas organ growth decreased process quality, abnormal gz15Tg + MO1-sar1b standard conditions Fig. 3 from Levic et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.