Morpholino

MO4-nphp4

ID
ZDB-MRPHLNO-141111-1
Name
MO4-nphp4
Previous Names
None
Target
Sequence
5' - GCTTCTCCACTCAGACATCAGAGGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nphp4
Expressed Gene Anatomy Figures
foxa3 Fig. 3 from French et al., 2012
myl7 Fig. 2 from French et al., 2012
shha Fig. S6 from French et al., 2012
spaw Fig. 3 from French et al., 2012
tbxta Fig. S6 from French et al., 2012
Phenotype
Phenotype resulting from MO4-nphp4
Phenotype Fish Figures
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO4-nphp4 Fig. 3 from French et al., 2012
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO4-nphp4 Fig. 3 from French et al., 2012
determination of liver left/right asymmetry process quality, abnormal WT + MO4-nphp4 Fig. 3 from French et al., 2012
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO4-nphp4 Fig. 3 from French et al., 2012
heart looping process quality, abnormal WT + MO4-nphp4 Fig. 2 from French et al., 2012
kidney cystic, abnormal WT + MO4-nphp4 Fig. S5 from French et al., 2012
Kupffer's vesicle motile cilium decreased fluid flow, abnormal WT + MO4-nphp4 Fig. 4 from French et al., 2012
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO4-nphp4 Fig. 4 from French et al., 2012
otolith amount, abnormal WT + MO4-nphp4 Fig. S5 from French et al., 2012
whole organism curved, abnormal WT + MO4-nphp4 Fig. S4 from French et al., 2012
Phenotype of all Fish created by or utilizing MO4-nphp4
Phenotype Fish Conditions Figures
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO4-nphp4 standard conditions Fig. 3 from French et al., 2012
determination of liver left/right asymmetry process quality, abnormal WT + MO4-nphp4 standard conditions Fig. 3 from French et al., 2012
whole organism curved, abnormal WT + MO4-nphp4 standard conditions Fig. S4 from French et al., 2012
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO4-nphp4 standard conditions Fig. 3 from French et al., 2012
heart looping process quality, abnormal WT + MO4-nphp4 standard conditions Fig. 2 from French et al., 2012
kidney cystic, abnormal WT + MO4-nphp4 standard conditions Fig. S5 from French et al., 2012
determination of digestive tract left/right asymmetry process quality, abnormal WT + MO4-nphp4 standard conditions Fig. 3 from French et al., 2012
Kupffer's vesicle motile cilium decreased fluid flow, abnormal WT + MO4-nphp4 standard conditions Fig. 4 from French et al., 2012
Kupffer's vesicle motile cilium decreased length, abnormal WT + MO4-nphp4 standard conditions Fig. 4 from French et al., 2012
otolith amount, abnormal WT + MO4-nphp4 standard conditions Fig. S5 from French et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.