Morpholino

MO1-exosc8

ID
ZDB-MRPHLNO-140929-1
Name
MO1-exosc8
Previous Names
None
Target
Sequence
5' - AGATTAACTCTCACCAGAAAGCTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-exosc8
Expressed Gene Anatomy Figures
mbpa Fig. 7 with image,  Fig. S3 with image from Boczonadi et al., 2014
mbpb Fig. 7 with image from Boczonadi et al., 2014
plp1a Fig. 7 with image from Boczonadi et al., 2014
pmp22a Fig. 7 with image from Boczonadi et al., 2014
Phenotype
Phenotype resulting from MO1-exosc8
Phenotype Fish Figures
brain development disrupted, abnormal rw0Tg + MO1-exosc8 Fig. 6 with image,  Fig. 8 with image from Boczonadi et al., 2014
eye decreased size, abnormal rw0Tg + MO1-exosc8 Fig. 6 with image from Boczonadi et al., 2014
eye shape, abnormal rw0Tg + MO1-exosc8 Fig. 6 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 Fig. 8 with image from Boczonadi et al., 2014
lateral line nerve myelin sheath absent, abnormal WT + MO1-exosc8 Fig. 7 with image from Boczonadi et al., 2014
midbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 Fig. 8 with image from Boczonadi et al., 2014
myelination of lateral line nerve axons disrupted, abnormal WT + MO1-exosc8 Fig. 7 with image from Boczonadi et al., 2014
pericardium edematous, abnormal rw0Tg + MO1-exosc8 Fig. 6 with image from Boczonadi et al., 2014
post-vent region decreased length, abnormal rw0Tg + MO1-exosc8 Fig. 6 with image from Boczonadi et al., 2014
sensory perception of touch disrupted, abnormal rw0Tg + MO1-exosc8 text only from Boczonadi et al., 2014
swimming disrupted, abnormal rw0Tg + MO1-exosc8 text only from Boczonadi et al., 2014
whole organism malformed, abnormal rw0Tg + MO1-exosc8 Fig. 6 with image from Boczonadi et al., 2014
Phenotype of all Fish created by or utilizing MO1-exosc8
Phenotype Fish Conditions Figures
lateral line nerve myelin sheath absent, abnormal WT + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
myelination of lateral line nerve axons disrupted, abnormal WT + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
swimming disrupted, abnormal rw0Tg + MO1-exosc8 standard conditions text only from Boczonadi et al., 2014
sensory perception of touch disrupted, abnormal rw0Tg + MO1-exosc8 standard conditions text only from Boczonadi et al., 2014
post-vent region decreased length, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
pericardium edematous, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
whole organism malformed, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
eye decreased size, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
brain development disrupted, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
eye shape, abnormal rw0Tg + MO1-exosc8 standard conditions Fig. 6 with image from Boczonadi et al., 2014
brain development disrupted, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
midbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
midbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
brain development disrupted, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal rw0Tg + MO1-exosc8 + MO1-mbpa + MO4-tp53 standard conditions Fig. 8 with image from Boczonadi et al., 2014
lateral line nerve myelin sheath absent, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
spinal cord curvature, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
myelination of lateral line nerve axons disrupted, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
hindbrain morphology, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. S3 with image from Boczonadi et al., 2014
motor neuron axon decreased thickness, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
motor neuron axon hypoplastic, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
spinal cord structure, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
myelination disrupted, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. S3 with image from Boczonadi et al., 2014
motor neuron axon decreased length, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. 7 with image from Boczonadi et al., 2014
brain development disrupted, abnormal slc24a5unspecified + MO1-exosc8 standard conditions Fig. S3 with image from Boczonadi et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.