Morpholino

MO2-ambra1b

ID
ZDB-MRPHLNO-140918-4
Name
MO2-ambra1b
Previous Names
None
Target
Sequence
5' - TGAAATTGATTGTTACCTATCTGGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ambra1b
Expressed Gene Anatomy Figures
chrd Fig. 13 from Benato et al., 2013
gsc Fig. 13 from Benato et al., 2013
myod1 Fig. 2 with image from Skobo et al., 2014
shha Fig. 13 from Benato et al., 2013
Phenotype
Phenotype resulting from MO2-ambra1b
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-ambra1b Fig. 12 from Benato et al., 2013
autophagy decreased process quality, abnormal WT + MO2-ambra1b Fig. 11 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO2-ambra1b Fig. 6 from Benato et al., 2013
eye decreased size, abnormal WT + MO2-ambra1b Fig. 6,  Fig. 9 from Benato et al., 2013
fast muscle cell undulate, abnormal AB + MO2-ambra1b Fig. 9 with image from Skobo et al., 2014
fourth ventricle hydrocephalic, abnormal WT + MO2-ambra1b Fig. 9 from Benato et al., 2013
head apoptotic, abnormal WT + MO2-ambra1b Fig. 12 from Benato et al., 2013
head decreased size, abnormal WT + MO2-ambra1b Fig. 6 from Benato et al., 2013
muscle sarcomere disorganized, abnormal AB + MO2-ambra1b Fig. 7 with image from Skobo et al., 2014
muscle cell disorganized, abnormal AB + MO2-ambra1b Fig. 3 with image,  Fig. 7 with image from Skobo et al., 2014
myoseptum decreased thickness, abnormal AB + MO2-ambra1b Fig. 3 with image from Skobo et al., 2014
otic vesicle decreased size, abnormal WT + MO2-ambra1b Fig. 9 from Benato et al., 2013
otolith decreased size, abnormal WT + MO2-ambra1b Fig. 6 from Benato et al., 2013
pericardium edematous, abnormal WT + MO2-ambra1b Fig. 9 from Benato et al., 2013
pigmentation delayed, abnormal WT + MO2-ambra1b Fig. 6 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO2-ambra1b Fig. 6,  Fig. 9 from Benato et al., 2013
primordial germ cell decreased amount, abnormal WT + MO2-ambra1b Fig. 3 with image from Fontana et al., 2023
trunk decreased size, abnormal WT + MO2-ambra1b Fig. 6 from Benato et al., 2013
whole organism dead, abnormal WT + MO2-ambra1b text only from Benato et al., 2013
whole organism deformed, abnormal WT + MO2-ambra1b Fig. 6 from Benato et al., 2013
Phenotype of all Fish created by or utilizing MO2-ambra1b
Phenotype Fish Conditions Figures
muscle cell disorganized, abnormal AB + MO2-ambra1b standard conditions Fig. 3 with image,  Fig. 7 with image from Skobo et al., 2014
fast muscle cell undulate, abnormal AB + MO2-ambra1b standard conditions Fig. 9 with image from Skobo et al., 2014
myoseptum decreased thickness, abnormal AB + MO2-ambra1b standard conditions Fig. 3 with image from Skobo et al., 2014
muscle sarcomere disorganized, abnormal AB + MO2-ambra1b standard conditions Fig. 7 with image from Skobo et al., 2014
trunk decreased size, abnormal WT + MO2-ambra1b standard conditions Fig. 6 from Benato et al., 2013
primordial germ cell decreased amount, abnormal WT + MO2-ambra1b control Fig. 3 with image from Fontana et al., 2023
pigmentation delayed, abnormal WT + MO2-ambra1b standard conditions Fig. 6 from Benato et al., 2013
head decreased size, abnormal WT + MO2-ambra1b standard conditions Fig. 6 from Benato et al., 2013
embryo development disrupted, abnormal WT + MO2-ambra1b standard conditions Fig. 6 from Benato et al., 2013
otic vesicle decreased size, abnormal WT + MO2-ambra1b standard conditions Fig. 9 from Benato et al., 2013
post-vent region kinked, abnormal WT + MO2-ambra1b standard conditions Fig. 6,  Fig. 9 from Benato et al., 2013
whole organism dead, abnormal WT + MO2-ambra1b standard conditions text only from Benato et al., 2013
whole organism deformed, abnormal WT + MO2-ambra1b standard conditions Fig. 6 from Benato et al., 2013
autophagy decreased process quality, abnormal WT + MO2-ambra1b standard conditions Fig. 11 from Benato et al., 2013
otolith decreased size, abnormal WT + MO2-ambra1b standard conditions Fig. 6 from Benato et al., 2013
apoptotic process increased occurrence, abnormal WT + MO2-ambra1b standard conditions Fig. 12 from Benato et al., 2013
eye decreased size, abnormal WT + MO2-ambra1b standard conditions Fig. 6,  Fig. 9 from Benato et al., 2013
head apoptotic, abnormal WT + MO2-ambra1b standard conditions Fig. 12 from Benato et al., 2013
fourth ventricle hydrocephalic, abnormal WT + MO2-ambra1b standard conditions Fig. 9 from Benato et al., 2013
pericardium edematous, abnormal WT + MO2-ambra1b standard conditions Fig. 9 from Benato et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.