Morpholino

MO3-tnfrsf19

ID

ZDB-MRPHLNO-140522-4

Name

MO3-tnfrsf19

Previous Names

Target

Sequence

5' - TCTCCGGTGATCTGCGCTCAGTAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO, targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-tnfrsf19

Expressed Gene	Anatomy	Figures
ackr3b	posterior lateral line primordium	Fig. 8 from Han et al., 2014
atoh1a	posterior lateral line primordium	Fig. 8 from Han et al., 2014
cxcr4b	posterior lateral line primordium	Fig. 8 from Han et al., 2014
dkk1b	posterior lateral line primordium	Fig. 8 from Han et al., 2014
etv4	posterior lateral line primordium	Fig. 8 from Han et al., 2014
eya1	posterior lateral line primordium	Fig. 6 from Han et al., 2014
fgfr1a	posterior lateral line primordium	Fig. 8 from Han et al., 2014
lef1	posterior lateral line primordium	Fig. 8 from Han et al., 2014

Phenotype

Phenotype resulting from MO3-tnfrsf19

Phenotype	Fish	Figures
anterior lateral line neuromast decreased amount, abnormal	WT + MO3-tnfrsf19	Fig. 2 from Han et al., 2014
posterior lateral line neuromast decreased amount, abnormal	WT + MO3-tnfrsf19	Fig. 2 from Han et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO3-tnfrsf19	Fig. 7 from Han et al., 2014
posterior lateral line primordium decreased size, abnormal	zf106Tg + MO3-tnfrsf19	Fig. 6 , Fig. 7 , Fig. 8 from Han et al., 2014
posterior lateral line primordium disorganized, abnormal	zf106Tg + MO3-tnfrsf19	Fig. 7 from Han et al., 2014
posterior lateral line primordium lacks parts or has fewer parts of type protoneuromast, abnormal	zf106Tg + MO3-tnfrsf19	Fig. 7 from Han et al., 2014

Phenotype of all Fish created by or utilizing MO3-tnfrsf19

Phenotype	Fish	Conditions	Figures
posterior lateral line primordium decreased size, abnormal	WT + MO3-tnfrsf19	standard conditions	Fig. 6 , Fig. 8 from Han et al., 2014
anterior lateral line neuromast decreased amount, abnormal	WT + MO3-tnfrsf19	standard conditions	Fig. 2 from Han et al., 2014
posterior lateral line neuromast decreased amount, abnormal	WT + MO3-tnfrsf19	standard conditions	Fig. 2 from Han et al., 2014
posterior lateral line primordium decreased size, abnormal	zf106Tg + MO3-tnfrsf19	standard conditions	Fig. 6 , Fig. 7 from Han et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO3-tnfrsf19	standard conditions	Fig. 7 from Han et al., 2014
posterior lateral line primordium disorganized, abnormal	zf106Tg + MO3-tnfrsf19	standard conditions	Fig. 7 from Han et al., 2014
posterior lateral line primordium lacks parts or has fewer parts of type protoneuromast, abnormal	zf106Tg + MO3-tnfrsf19	standard conditions	Fig. 7 from Han et al., 2014

Citations