Morpholino

MO1-hsbp1b

ID
ZDB-MRPHLNO-140430-2
Name
MO1-hsbp1b
Previous Names
None
Target
Sequence
5' - CTGATTTTGGGTCTGTCTGTGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hsbp1b
Expressed Gene Anatomy Figures
cdh1 Fig. 6 with image from Eroglu et al., 2014
egr2b Fig. S8 with image from Eroglu et al., 2014
en2a Fig. S8 with image from Eroglu et al., 2014
foxd3 Fig. 5 with image,  Fig. 6 with image from Eroglu et al., 2014
hesx1 Fig. S8 with image from Eroglu et al., 2014
hlx1 Fig. S8 with image from Eroglu et al., 2014
hsp70l Fig. 6 with image from Eroglu et al., 2014
hsp90aa1.2 Fig. 6 with image from Eroglu et al., 2014
hsph1 Fig. 6 with image from Eroglu et al., 2014
snai1b Fig. 5 with image,  Fig. 6 with image from Eroglu et al., 2014
snai2 Fig. 6 with image from Eroglu et al., 2014
tbxta Fig. S8 with image from Eroglu et al., 2014
tfap2a Fig. 5 with image,  Fig. 6 with image from Eroglu et al., 2014
Phenotype
Phenotype resulting from MO1-hsbp1b
Phenotype Fish Figures
anatomical structure snai1b expression increased amount, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
anatomical structure foxd3 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
central nervous system apoptotic, abnormal WT + MO1-hsbp1b text only from Eroglu et al., 2014
central nervous system physical object quality, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
central nervous system development disrupted, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b + MO4-tp53 Fig. S7 with image from Eroglu et al., 2014
forebrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
forebrain neural plate hesx1 expression increased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 Fig. S7 with image,  Table S3 with image from Eroglu et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b Table S3 with image from Eroglu et al., 2014
hindbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary en2a expression absent, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural keel en2a expression absent, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural plate en2a expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
neural crest formation process quality, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
non neural ectoderm tfap2a expression increased amount, abnormal WT + MO1-hsbp1b Fig. 5 with image from Eroglu et al., 2014
notochord tbxta expression spatial pattern, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
presumptive rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
presumptive rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b Fig. S8 with image from Eroglu et al., 2014
whole organism cdh1 expression decreased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b + MO4-tp53 Fig. S7 with image from Eroglu et al., 2014
whole organism hsph1 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism hsp70l expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism snai1b expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism foxd3 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism tfap2a expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism hsp90aa1.2 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism snai2 expression increased amount, abnormal WT + MO1-hsbp1b Fig. 6 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b + MO4-tp53 Fig. S7 with image,  Table S3 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b + MO4-tp53 Table S3 with image from Eroglu et al., 2014
Phenotype of all Fish created by or utilizing MO1-hsbp1b
Phenotype Fish Conditions Figures
midbrain hindbrain boundary en2a expression absent, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b standard conditions Table S3 with image from Eroglu et al., 2014
whole organism hsp70l expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
central nervous system physical object quality, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b standard conditions Table S3 with image from Eroglu et al., 2014
neural crest formation process quality, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with image from Eroglu et al., 2014
forebrain neural plate hesx1 expression increased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism snai2 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with image from Eroglu et al., 2014
whole organism hsp90aa1.2 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
central nervous system apoptotic, abnormal WT + MO1-hsbp1b standard conditions text only from Eroglu et al., 2014
notochord tbxta expression spatial pattern, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural keel en2a expression absent, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
anatomical structure snai1b expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
presumptive rhombomere 3 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
presumptive rhombomere 5 egr2b expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism snai1b expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
non neural ectoderm tfap2a expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
midbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
forebrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with image,  Table S3 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b standard conditions Fig. S7 with image,  Table S3 with image from Eroglu et al., 2014
central nervous system development disrupted, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism tfap2a expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
midbrain hindbrain boundary neural plate en2a expression decreased distribution, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
anatomical structure foxd3 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 5 with image from Eroglu et al., 2014
whole organism foxd3 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
hindbrain hlx1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. S8 with image from Eroglu et al., 2014
whole organism cdh1 expression decreased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
whole organism hsph1 expression increased amount, abnormal WT + MO1-hsbp1b standard conditions Fig. 6 with image from Eroglu et al., 2014
embryo development disrupted, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
yolk increased size, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
head deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image,  Table S3 with image from Eroglu et al., 2014
heart deformed, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Table S3 with image from Eroglu et al., 2014
whole organism decreased length, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image from Eroglu et al., 2014
whole organism anterior-posterior axis increased curvature, abnormal WT + MO1-hsbp1b + MO4-tp53 standard conditions Fig. S7 with image,  Table S3 with image from Eroglu et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.