Morpholino

MO2-pdcd2

ID
ZDB-MRPHLNO-140106-3
Name
MO2-pdcd2
Previous Names
  • 5ssMO (1)
Target
Sequence
5' - TAACATCTGTTTTGCATCACCTGGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pdcd2
Expressed Gene Anatomy Figures
efnb2a Fig. 3 from Kramer et al., 2013
hbae1.1 Fig. 4 from Kramer et al., 2013
kdrl Fig. 3 from Kramer et al., 2013
lck Fig. 5 from Kramer et al., 2013
lcp1 Fig. 5 from Kramer et al., 2013
mpx Fig. 5 from Kramer et al., 2013
myb Fig. 5 from Kramer et al., 2013
rag1 Fig. 5 from Kramer et al., 2013
runx1 Fig. 5,  Fig. 7 from Kramer et al., 2013
Phenotype
Phenotype resulting from MO2-pdcd2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO2-pdcd2 Fig. 6,  Fig. 7 from Kramer et al., 2013
axis decreased length, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
blood vessel has fewer parts of type blood cell, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
blood vessel blood lacks parts or has fewer parts of type nucleate erythrocyte, abnormal sd2Tg + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
brain necrotic, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
caudal fin curled, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
caudal fin increased thickness, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
caudal vein plexus malformed, abnormal y1Tg + MO2-pdcd2 Fig. 3 from Kramer et al., 2013
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO2-pdcd2 Fig. 3 from Kramer et al., 2013
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-pdcd2 Fig. 3 from Kramer et al., 2013
erythroblast increased amount, abnormal sd2Tg + MO2-pdcd2 Fig. 4 from Kramer et al., 2013
erythroblast increased size, abnormal sd2Tg + MO2-pdcd2 Fig. 4 from Kramer et al., 2013
erythroblast nucleus increased size, abnormal sd2Tg + MO2-pdcd2 Fig. 4 from Kramer et al., 2013
erythrocyte differentiation arrested, abnormal sd2Tg + MO2-pdcd2 Fig. 4 from Kramer et al., 2013
eye decreased size, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
hematopoietic stem cell absent, abnormal WT + MO2-pdcd2 Fig. 5 from Kramer et al., 2013
hematopoietic system cell accumulation ball anterior region, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
mitotic cell cycle process quality, abnormal WT + MO2-pdcd2 Fig. 6 from Kramer et al., 2013
mitotic spindle assembly process quality, abnormal WT + MO2-pdcd2 Fig. 6 from Kramer et al., 2013
nucleate erythrocyte accumulation intermediate cell mass of mesoderm, abnormal sd2Tg + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
nucleate erythrocyte accumulation common cardinal vein, abnormal sd2Tg + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
nucleate erythrocyte immature, abnormal sd2Tg + MO2-pdcd2 Fig. 4 from Kramer et al., 2013
somite deformed, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
ventricular system dilated, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
whole organism circulating cell lacks parts or has fewer parts of type blood cell, abnormal WT + MO2-pdcd2 Fig. 2 from Kramer et al., 2013
Phenotype of all Fish created by or utilizing MO2-pdcd2
Phenotype Fish Conditions Figures
brain necrotic, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
whole organism circulating cell lacks parts or has fewer parts of type blood cell, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
somite deformed, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
mitotic cell cycle process quality, abnormal WT + MO2-pdcd2 standard conditions Fig. 6 from Kramer et al., 2013
apoptotic process increased occurrence, abnormal WT + MO2-pdcd2 standard conditions Fig. 6,  Fig. 7 from Kramer et al., 2013
eye decreased size, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
hematopoietic system cell accumulation ball anterior region, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
hematopoietic stem cell absent, abnormal WT + MO2-pdcd2 standard conditions Fig. 5 from Kramer et al., 2013
axis decreased length, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
mitotic spindle assembly process quality, abnormal WT + MO2-pdcd2 standard conditions Fig. 6 from Kramer et al., 2013
ventricular system dilated, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
blood vessel has fewer parts of type blood cell, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
caudal fin curled, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
caudal fin increased thickness, abnormal WT + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
nucleate erythrocyte accumulation common cardinal vein, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
erythroblast nucleus increased size, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 4 from Kramer et al., 2013
nucleate erythrocyte accumulation intermediate cell mass of mesoderm, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
erythroblast increased size, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 4 from Kramer et al., 2013
blood vessel blood lacks parts or has fewer parts of type nucleate erythrocyte, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 2 from Kramer et al., 2013
nucleate erythrocyte immature, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 4 from Kramer et al., 2013
erythroblast increased amount, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 4 from Kramer et al., 2013
erythrocyte differentiation arrested, abnormal sd2Tg + MO2-pdcd2 standard conditions Fig. 4 from Kramer et al., 2013
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO2-pdcd2 standard conditions Fig. 3 from Kramer et al., 2013
caudal vein plexus malformed, abnormal y1Tg + MO2-pdcd2 standard conditions Fig. 3 from Kramer et al., 2013
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-pdcd2 standard conditions Fig. 3 from Kramer et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.