Morpholino

MO1-hs3st3l

ID
ZDB-MRPHLNO-131108-8
Name
MO1-hs3st3l
Previous Names
  • 3-OST-6 MO1, Translational start site (1)
Target
Sequence
5' - CGTTGAGGACTCTCTGTGATCGGCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hs3st3l
Expressed Gene Anatomy Figures
dnah9 Fig. 5 with image from Neugebauer et al., 2013
foxj1a Fig. 5 with image from Neugebauer et al., 2013
il17rd Fig. 5 with image from Neugebauer et al., 2013
kif3b Fig. 5 with image from Neugebauer et al., 2013
lft1 Fig. S2 with image from Neugebauer et al., 2013
rfx2 Fig. 5 with image from Neugebauer et al., 2013
shha Fig. S2 with image from Neugebauer et al., 2013
Phenotype
Phenotype resulting from MO1-hs3st3l
Phenotype Fish Figures
gut left/right pattern formation process quality, abnormal WT + MO1-hs3st3l Fig. 4 with image from Neugebauer et al., 2013
heart looping process quality, abnormal WT + MO1-hs3st3l Fig. 4 with image from Neugebauer et al., 2013
Kupffer's vesicle has fewer parts of type ciliated cell inner dynein arm, abnormal WT + MO1-hs3st3l Fig. 5 with image from Neugebauer et al., 2013
Kupffer's vesicle has fewer parts of type ciliated cell outer dynein arm, abnormal WT + MO1-hs3st3l Fig. 5 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium decreased speed, abnormal WT + MO1-hs3st3l Fig. 4 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium immobile, abnormal WT + MO1-hs3st3l Fig. 4 with image from Neugebauer et al., 2013
left/right pattern formation process quality, abnormal WT + MO1-hs3st3l Fig. 4 with image from Neugebauer et al., 2013
Phenotype of all Fish created by or utilizing MO1-hs3st3l
Phenotype Fish Conditions Figures
heart looping process quality, abnormal WT + MO1-hs3st3l standard conditions Fig. 4 with image from Neugebauer et al., 2013
Kupffer's vesicle has fewer parts of type ciliated cell outer dynein arm, abnormal WT + MO1-hs3st3l standard conditions Fig. 5 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium decreased speed, abnormal WT + MO1-hs3st3l standard conditions Fig. 4 with image from Neugebauer et al., 2013
left/right pattern formation process quality, abnormal WT + MO1-hs3st3l standard conditions Fig. 4 with image from Neugebauer et al., 2013
gut left/right pattern formation process quality, abnormal WT + MO1-hs3st3l standard conditions Fig. 4 with image from Neugebauer et al., 2013
Kupffer's vesicle has fewer parts of type ciliated cell inner dynein arm, abnormal WT + MO1-hs3st3l standard conditions Fig. 5 with image from Neugebauer et al., 2013
Kupffer's vesicle motile cilium immobile, abnormal WT + MO1-hs3st3l standard conditions Fig. 4 with image from Neugebauer et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.