Morpholino
MO5-appb
- ID
- ZDB-MRPHLNO-131025-3
- Name
- MO5-appb
- Previous Names
- None
- Target
- Sequence
-
5' - CTCTTTTCTCTCTCATTACCTCTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-appb
Expressed Gene | Anatomy | Figures |
---|---|---|
appb |
Fig. 1 ![]() |
|
dla |
Fig. 4 ![]() |
|
dld |
Fig. 4 ![]() |
|
egr2b |
Fig. 8 ![]() |
|
fgf3 |
Fig. 8 ![]() |
1 - 5 of 10 Show all
Phenotype
Phenotype resulting from MO5-appb
1 - 5 of 20 Show all
Phenotype of all Fish created by or utilizing MO5-appb
1 - 5 of 22 Show all
Citations
- Rahmati, M., Chebli, J., Banote, R.K., Roselli, S., Agholme, L., Zetterberg, H., Abramsson, A. (2024) Fine-tuning amyloid precursor protein expression through non-sense mediated mRNA decay. eNeuro. 11(6):
- Banote, R.K., Edling, M., Eliassen, F., Kettunen, P., Zetterberg, H., Abramsson, A. (2016) β-Amyloid precursor protein-b is essential for Mauthner cell development in the zebrafish in a Notch-dependent manner. Developmental Biology. 413(1):26-38
- Abramsson, A., Kettunen, P., Banote, R.K., Lott, E., Li, M., Arner, A., and Zetterberg, H. (2013) The zebrafish amyloid precursor protein-b is required for motor neuron guidance and synapse formation. Developmental Biology. 381(2):377-88
1 - 3 of 3
Show