Morpholino

MO2-thraa

ID
ZDB-MRPHLNO-130306-1
Name
MO2-thraa
Previous Names
  • Thraa#1 (1)
Target
Sequence
5' - TGTGCTCCTGCTCTGTGTTTTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-thraa
Expressed Gene Anatomy Figures
aldh1a2 Fig. 4 with image from Bohnsack et al., 2013
cyp26c1 Fig. 4 with image from Bohnsack et al., 2013
myhz2 Fig. 3 with image from Bohnsack et al., 2013
myod1 Fig. 3 with image from Bohnsack et al., 2013
pitx2 Fig. 4 with image from Bohnsack et al., 2013
twist1a Fig. 4 with image from Bohnsack et al., 2013
tyr Fig. 4 with image from Bohnsack et al., 2013
Phenotype
Phenotype resulting from MO2-thraa
Phenotype Fish Figures
dorsal oblique extraocular muscle myhz2 expression decreased amount, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
dorsal oblique extraocular muscle morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
dorsal rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
dorsal rectus morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
extraocular musculature myod1 expression increased amount, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
extraocular musculature myod1 expression increased distribution, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
extraocular musculature morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
hindbrain cyp26c1 expression increased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
lateral rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
lateral rectus morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
mandibular arch skeleton aldh1a2 expression absent, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
medial rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
medial rectus morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
otic vesicle cyp26c1 expression increased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme aldh1a2 expression absent, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme pitx2 expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch muscle morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
pharyngeal arch 1 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 2 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3-7 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 4 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 5 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 6 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 7 twist1a expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
retina cyp26c1 expression increased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
retina ventral region aldh1a2 expression absent, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
ventral oblique extraocular muscle myhz2 expression decreased amount, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
ventral oblique extraocular muscle morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
ventral rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
ventral rectus morphology, abnormal WT + MO2-thraa Fig. 3 with image from Bohnsack et al., 2013
whole organism aldh1a2 expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
whole organism tyr expression decreased amount, abnormal WT + MO2-thraa Fig. 4 with image from Bohnsack et al., 2013
Phenotype of all Fish created by or utilizing MO2-thraa
Phenotype Fish Conditions Figures
retina cyp26c1 expression increased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
dorsal rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
dorsal rectus morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
pharyngeal arch 6 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme pitx2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
periocular mesenchyme aldh1a2 expression absent, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
whole organism tyr expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
ventral rectus morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
pharyngeal arch 2 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
hindbrain cyp26c1 expression increased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
medial rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
medial rectus morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
pharyngeal arch 5 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
extraocular musculature morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
pharyngeal arch 1 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
extraocular musculature myod1 expression increased amount, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
retina ventral region aldh1a2 expression absent, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
dorsal oblique extraocular muscle myhz2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
whole organism aldh1a2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch muscle morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
pharyngeal arch 4 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
dorsal oblique extraocular muscle morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
extraocular musculature myod1 expression increased distribution, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
ventral oblique extraocular muscle morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
mandibular arch skeleton aldh1a2 expression absent, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 7 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
otic vesicle cyp26c1 expression increased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
pharyngeal arch 3-7 twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
lateral rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
ventral oblique extraocular muscle myhz2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
pharyngeal arch twist1a expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 4 with image from Bohnsack et al., 2013
ventral rectus myhz2 expression decreased amount, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
lateral rectus morphology, abnormal WT + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
Meckel's cartilage malformed, abnormal mpv17a9/a9; ba2Tg + MO2-thraa standard conditions Fig. 2 with image from Bohnsack et al., 2013
pharyngeal arch decreased amount, abnormal mpv17a9/a9; ba2Tg + MO2-thraa standard conditions Fig. 2 with image from Bohnsack et al., 2013
cornea lacks parts or has fewer parts of type corneal endothelium, abnormal mpv17a9/a9; ba2Tg + MO2-thraa standard conditions Fig. 2 with image from Bohnsack et al., 2013
corneal epithelium increased thickness, abnormal mpv17a9/a9; ba2Tg + MO2-thraa standard conditions Fig. 2 with image from Bohnsack et al., 2013
corneal epithelium scalloped, abnormal mpv17a9/a9; ba2Tg + MO2-thraa standard conditions Fig. 2 with image from Bohnsack et al., 2013
ceratohyal cartilage malformed, abnormal mpv17a9/a9; ba2Tg + MO2-thraa standard conditions Fig. 2 with image from Bohnsack et al., 2013
ceratohyal cartilage malformed, abnormal mpv17a9/a9; ba2Tg + MO2-thraa + MO4-tp53 standard conditions Fig. S3 with image from Bohnsack et al., 2013
Meckel's cartilage malformed, abnormal mpv17a9/a9; ba2Tg + MO2-thraa + MO4-tp53 standard conditions Fig. S3 with image from Bohnsack et al., 2013
ventral oblique extraocular muscle morphology, abnormal mpv17a9/a9; zf13Tg + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
ventral rectus morphology, abnormal mpv17a9/a9; zf13Tg + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
dorsal rectus morphology, abnormal mpv17a9/a9; zf13Tg + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
dorsal oblique extraocular muscle morphology, abnormal mpv17a9/a9; zf13Tg + MO2-thraa standard conditions Fig. 3 with image from Bohnsack et al., 2013
neural crest cell migration disrupted, abnormal mpv17a9; zf15Tg + MO2-thraa standard conditions Fig. 1 with image from Bohnsack et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.