Morpholino
MO1-msgn1
- ID
- ZDB-MRPHLNO-121205-1
- Name
- MO1-msgn1
- Previous Names
- None
- Target
- Sequence
-
5' - CACATCCACGTCGATTTGCGCCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-msgn1
Expressed Gene | Anatomy | Figures |
---|---|---|
msgn1 |
Fig. 4 ![]() |
|
myod1 |
Fig. 1 ![]() Fig. 1 ![]() |
|
pcdh8 |
Fig. 2 ![]() |
|
snai1a |
Fig. 6 ![]() |
|
tbx6 |
Fig. 1 ![]() Fig. 2 ![]() |
1 - 5 of 9 Show all
Phenotype
Phenotype resulting from MO1-msgn1
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-msgn1
1 - 5 of 18 Show all
Citations
- Row, R.H., Pegg, A., Kinney, B., Farr, G.H., Maves, L., Lowell, S., Wilson, V., Martin, B.L. (2018) BMP and FGF signaling interact to pattern mesoderm by controlling basic helix-loop-helix transcription factor activity. eLIFE. 7
- Bouldin, C.M., Manning, A.J., Peng, Y.H., Farr, G.H., Hung, K.L., Dong, A., Kimelman, D. (2015) Wnt signaling and tbx16 form a bistable switch to commit bipotential progenitors to mesoderm. Development (Cambridge, England). 142:2499-507
- Manning, A.J., Kimelman, D. (2015) Tbx16 and Msgn1 are required to establish directional cell migration of zebrafish mesodermal progenitors. Developmental Biology. 406(2):172-85
- Fior, R., Maxwell, A.A., Ma, T.P., Vezzaro, A., Moens, C.B., Amacher, S.L., Lewis, J., and Saúde, L. (2012) The differentiation and movement of presomitic mesoderm progenitor cells are controlled by Mesogenin 1. Development (Cambridge, England). 139(24):4656-4665
- Yabe, T., and Takada, S. (2012) Mesogenin causes embryonic mesoderm progenitors to differentiate during development of zebrafish tail somites. Developmental Biology. 370(2):213-222
1 - 5 of 5
Show