Morpholino
MO3-myef2
- ID
- ZDB-MRPHLNO-121010-1
- Name
- MO3-myef2
- Previous Names
- None
- Target
- Sequence
-
5' - CTCACCAACTACATGAGACATACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-myef2
Expressed Gene | Anatomy | Figures |
---|---|---|
gata1a |
Fig. 7
from van Riel et al., 2012 |
|
ikzf1 |
|
Fig. 7
from van Riel et al., 2012 |
myb |
Fig. 7
from van Riel et al., 2012 |
|
rag1 |
|
Fig. 7
from van Riel et al., 2012 |
runx1 |
Fig. 7
from van Riel et al., 2012 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO3-myef2
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO3-myef2
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
hematopoietic stem cell decreased amount, abnormal | WT + MO3-myef2 | standard conditions |
Fig. 7
from van Riel et al., 2012 |
definitive hemopoiesis disrupted, abnormal | WT + MO3-myef2 | standard conditions |
Fig. 7
from van Riel et al., 2012 |
1 - 2 of 2
Citations