Morpholino
MO4-pax2a
- ID
- ZDB-MRPHLNO-120807-1
- Name
- MO4-pax2a
- Previous Names
- None
- Target
- Sequence
-
5' - ATATGGTGTCTCACCTATAGTGTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-pax2a
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| afap1l2 |
Fig. 6 
from Cao et al., 2018 |
1 - 1 of 1
Phenotype
Phenotype resulting from MO4-pax2a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO4-pax2a
1 - 4 of 4
Citations
- Cao, M., Ouyang, J., Guo, J., Lin, S., Chen, S. (2018) Metalloproteinase Adamts16 Is Required for Proper Closure of the Optic Fissure. Investigative ophthalmology & visual science. 59:1167-1177
- Cao, M., Ouyang, J., Liang, H., Guo, J., Lin, S., Yang, S., Xie, T., Chen, S. (2018) Regional Gene Expression Profile Comparison Reveals the Unique Transcriptome of the Optic Fissure. Investigative ophthalmology & visual science. 59:5773-5784
- D'Aniello, E., Ravisankar, P., Waxman, J.S. (2015) Rdh10a Provides a Conserved Critical Step in the Synthesis of Retinoic Acid during Zebrafish Embryogenesis. PLoS One. 10:e0138588
- Gerlach, G.F., Wingert, R.A. (2014) Zebrafish pronephros tubulogenesis and epithelial identity maintenance are reliant on the polarity proteins Prkc iota and zeta. Developmental Biology. 396(2):183-200
- McCarroll, M.N., Lewis, Z.R., Culbertson, M.D., Martin, B.L., Kimelman, D., and Nechiporuk, A.V. (2012) Graded levels of Pax2a and Pax8 regulate cell differentiation during sensory placode formation. Development (Cambridge, England). 139(15):2740-2750
1 - 5 of 5
Show