Morpholino

MO1-ddt

ID
ZDB-MRPHLNO-120323-4
Name
MO1-ddt
Previous Names
  • mif-like MO1 (1)
Target
Sequence
5' - GTTTCTATATTTATGAACGGCATGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ddt
No data available
Phenotype
Phenotype resulting from MO1-ddt
No data available
Phenotype of all Fish created by or utilizing MO1-ddt
Phenotype Fish Conditions Figures
central nervous system attenuate, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 5 with image from Shen et al., 2012
eye attenuate, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 5 with image from Shen et al., 2012
statoacoustic (VIII) ganglion decreased size, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 8 with image from Shen et al., 2012
head decreased size, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 5 with image from Shen et al., 2012
macula utricle has fewer parts of type hair cell, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 6 with image from Shen et al., 2012
brain decreased size, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 5 with image from Shen et al., 2012
brain apoptotic, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 5 with image from Shen et al., 2012
inner ear attenuate, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 5 with image from Shen et al., 2012
semicircular canal malformed, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 7 with image from Shen et al., 2012
cranial ganglion neuron projection decreased length, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 8 with image from Shen et al., 2012
pillar of the semicircular canal unfused from pillar of the semicircular canal, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 7 with image from Shen et al., 2012
macula saccule has fewer parts of type hair cell, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 6 with image from Shen et al., 2012
dorsal anterior lateral line ganglion decreased size, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 8 with image from Shen et al., 2012
inner ear apoptotic, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 5 with image from Shen et al., 2012
statoacoustic (VIII) ganglion has fewer parts of type neuroblast, abnormal WT + MO1-ddt + MO2-ddt + MO4-mif standard conditions Fig. 8 with image from Shen et al., 2012
Citations