Morpholino

MO4-mif

ID

ZDB-MRPHLNO-120323-3

Name

MO4-mif

Previous Names

None

Target

mif (1)

Sequence

5' - ACATCGGCATGACTGCGACAGAGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-mif

No data available

Phenotype

Phenotype resulting from MO4-mif

Phenotype	Fish	Figures
macula saccule has fewer parts of type hair cell, abnormal	WT + MO4-mif	Fig. 3 from Weber et al., 2017
posterior macula has fewer parts of type hair cell, abnormal	WT + MO4-mif	Fig. 3, Fig. 4, Fig. 5 from Holmes et al., 2011

Phenotype of all Fish created by or utilizing MO4-mif

Phenotype	Fish	Conditions	Figures
posterior macula has fewer parts of type hair cell, abnormal	WT + MO4-mif	standard conditions	Fig. 3, Fig. 4, Fig. 5 from Holmes et al., 2011
macula saccule has fewer parts of type hair cell, abnormal	WT + MO4-mif	standard conditions	Fig. 3 from Weber et al., 2017
central nervous system attenuate, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 5 from Shen et al., 2012
eye attenuate, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 5 from Shen et al., 2012
statoacoustic (VIII) ganglion decreased size, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 8 from Shen et al., 2012
head decreased size, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 5 from Shen et al., 2012
macula utricle has fewer parts of type hair cell, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 6 from Shen et al., 2012
brain decreased size, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 5 from Shen et al., 2012
brain apoptotic, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 5 from Shen et al., 2012
inner ear attenuate, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 5 from Shen et al., 2012
semicircular canal malformed, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 7 from Shen et al., 2012
cranial ganglion neuron projection decreased length, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 8 from Shen et al., 2012
pillar of the semicircular canal unfused from pillar of the semicircular canal, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 7 from Shen et al., 2012
macula saccule has fewer parts of type hair cell, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 6 from Shen et al., 2012
dorsal anterior lateral line ganglion decreased size, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 8 from Shen et al., 2012
inner ear apoptotic, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 5 from Shen et al., 2012
statoacoustic (VIII) ganglion has fewer parts of type neuroblast, abnormal	WT + MO1-ddt + MO2-ddt + MO4-mif	standard conditions	Fig. 8 from Shen et al., 2012
macula utricle has fewer parts of type hair cell, abnormal	WT + MO1-mcp1 + MO4-mif	standard conditions	Fig. 4 from Weber et al., 2017
macula saccule has fewer parts of type hair cell, abnormal	WT + MO2-cops5 + MO4-mif	standard conditions	Fig. 3 from Weber et al., 2017

Citations