Morpholino

MO1-popdc2

ID
ZDB-MRPHLNO-120322-2
Name
MO1-popdc2
Previous Names
None
Target
Sequence
5' - CTAATCCTGTGAAAGCAGAAGATCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO. The author provided this corrected sequence.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-popdc2
No data available
Phenotype
Phenotype resulting from MO1-popdc2
Phenotype Fish Figures
cardiac conduction disrupted, abnormal s878Tg + MO1-popdc2 Fig. 8 with imageFig. 9 with image from Kirchmaier et al., 2012
fin musculature disorganized, abnormal WT + MO1-popdc2 Fig. 5 with image from Kirchmaier et al., 2012
heart electrical conductivity, abnormal s878Tg + MO1-popdc2 Fig. 9 with image from Kirchmaier et al., 2012
heart contraction arrhythmic, abnormal WT + MO1-popdc2 Fig. 8 with image from Kirchmaier et al., 2012
heart contraction decreased frequency, abnormal WT + MO1-popdc2 Fig. 8 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 Fig. 2 with imageFig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction decreased thickness, abnormal WT + MO1-popdc2 Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction irregular spatial pattern, abnormal WT + MO1-popdc2 Fig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction structure, abnormal WT + MO1-popdc2 Fig. 4 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
pericardium edematous, abnormal WT + MO1-popdc2 Fig. 5 with image from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 Fig. 2 with image from Kirchmaier et al., 2012
skeletal muscle fiber development disrupted, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
trunk musculature disorganized, abnormal WT + MO1-popdc2 Fig. 5 with imagetext only from Kirchmaier et al., 2012
whole organism balance, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
whole organism circling, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
whole organism uncoordinated, abnormal WT + MO1-popdc2 text only from Kirchmaier et al., 2012
Phenotype of all Fish created by or utilizing MO1-popdc2
Phenotype Fish Conditions Figures
heart contraction arrhythmic, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
whole organism circling, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
fin musculature disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with image from Kirchmaier et al., 2012
whole organism uncoordinated, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
heart contraction decreased frequency, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
myotome muscle tendon junction structure, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
cardiac conduction disrupted, abnormal WT + MO1-popdc2 standard conditions Fig. 8 with image from Kirchmaier et al., 2012
whole organism balance, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
skeletal muscle fiber development disrupted, abnormal WT + MO1-popdc2 standard conditions text only from Kirchmaier et al., 2012
trunk musculature disorganized, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with imagetext only from Kirchmaier et al., 2012
myotome muscle tendon junction irregular spatial pattern, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with imageFig. 4 with image from Kirchmaier et al., 2012
myotome muscle tendon junction decreased thickness, abnormal WT + MO1-popdc2 standard conditions Fig. 4 with image from Kirchmaier et al., 2012
pericardium edematous, abnormal WT + MO1-popdc2 standard conditions Fig. 5 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
atrium orientation cardiac ventricle, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
skeletal muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
cardiac muscle cell myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
heart looping process quality, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
skeletal muscle cell decreased mass, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome U-shaped, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
slow muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
fast muscle cell disorganized, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
slow muscle cell misaligned with slow muscle cell, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
fast muscle cell variant shape, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
slow muscle cell undulate, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 3 with image from Kirchmaier et al., 2012
myotome myofibril distributed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
heart malformed, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 7 with image from Kirchmaier et al., 2012
myotome myofibril decreased amount, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
myotome irregular spatial pattern, abnormal WT + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 2 with image from Kirchmaier et al., 2012
heart electrical conductivity, abnormal s878Tg + MO1-popdc2 standard conditions Fig. 9 with image from Kirchmaier et al., 2012
cardiac conduction disrupted, abnormal s878Tg + MO1-popdc2 standard conditions Fig. 9 with image from Kirchmaier et al., 2012
cephalic musculature hypoplastic, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
cephalic musculature malformed, abnormal zf13Tg + MO1-popdc2 + MO2-popdc2 standard conditions Fig. 6 with image from Kirchmaier et al., 2012
Citations