Morpholino

MO1-glrx2

ID
ZDB-MRPHLNO-120127-9
Name
MO1-glrx2
Previous Names
None
Target
Sequence
5' - GTTGAAGATACTAGGAAAGCAAACG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-glrx2
Expressed Gene Anatomy Figures
crestin Fig. 3 from Berndt et al., 2014
foxd3 Fig. 5 from Berndt et al., 2014
glrx2 Fig. 1 with image from Bräutigam et al., 2011
myl7 Fig. 2,  Fig. 3 from Berndt et al., 2014
Phenotype
Phenotype resulting from MO1-glrx2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-glrx2 Fig. 1 with image from Bräutigam et al., 2011
apoptotic process increased process quality, abnormal WT + MO1-glrx2 Fig. 5 from Berndt et al., 2014
cell death increased process quality, abnormal WT + MO1-glrx2 Fig. 5 from Berndt et al., 2014
central nervous system apoptotic, abnormal WT + MO1-glrx2 Fig. 1 with image from Bräutigam et al., 2011
central nervous system has fewer parts of type white matter, abnormal WT + MO1-glrx2 Fig. 2 with image from Bräutigam et al., 2011
central nervous system development disrupted, abnormal WT + MO1-glrx2 Fig. 2 with image,  Fig. 4 with image from Bräutigam et al., 2011
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-glrx2 Fig. 2 with image,  Fig. 3 with image from Bräutigam et al., 2011
common cardinal vein blood circulation decreased process quality, abnormal WT + MO1-glrx2 Fig. 1 from Berndt et al., 2014
dopaminergic neuron decreased amount, abnormal WT + MO1-glrx2 Fig. 2 with image from Bräutigam et al., 2011
dorsal aorta blood circulation decreased process quality, abnormal WT + MO1-glrx2 Fig. 1 from Berndt et al., 2014
eye apoptotic, abnormal WT + MO1-glrx2 Fig. 1 with image from Bräutigam et al., 2011
forebrain apoptotic, abnormal WT + MO1-glrx2 Fig. 1 with image from Bräutigam et al., 2011
glioblast (sensu Vertebrata) cell migration decreased process quality, abnormal vu12Tg + MO1-glrx2 Fig. 2 with image from Wilms et al., 2021
glutamatergic neuron decreased amount, abnormal WT + MO1-glrx2 Fig. 2 with image from Bräutigam et al., 2011
heart contraction process quality, abnormal WT + MO1-glrx2 Fig. 1 from Berndt et al., 2014
heart looping process quality, abnormal WT + MO1-glrx2 Fig. 2 from Berndt et al., 2014
hindbrain apoptotic, abnormal WT + MO1-glrx2 Fig. 1 with image,  Fig. S3 with image from Bräutigam et al., 2011
intersegmental vessel malformed, abnormal y1Tg + MO1-glrx2 Fig. 1 with image from Bräutigam et al., 2013
mechanosensory behavior disrupted, abnormal WT + MO1-glrx2 text only from Bräutigam et al., 2011
neural crest cell migration process quality, abnormal WT + MO1-glrx2 Fig. 3 from Berndt et al., 2014
neural crest cell migration involved in heart formation process quality, abnormal WT + MO1-glrx2 Fig. 3 from Berndt et al., 2014
neuron apoptotic, abnormal WT + MO1-glrx2 Fig. S3 with image from Bräutigam et al., 2011
neuron decreased amount, abnormal nns1Tg + MO1-glrx2 Fig. 2 with image from Bräutigam et al., 2011
neuron axon decreased branchiness, abnormal WT + MO1-glrx2 Fig. 3 with image from Bräutigam et al., 2011
neuron axon decreased length, abnormal WT + MO1-glrx2 Fig. 3 with image from Bräutigam et al., 2011
neuron projection development disrupted, abnormal WT + MO1-glrx2 Fig. 3 with image from Bräutigam et al., 2011
secondary motor neuron decreased amount, abnormal WT + MO1-glrx2 Fig. 2 with image from Bräutigam et al., 2011
spinal cord apoptotic, abnormal WT + MO1-glrx2 Fig. 1 with image,  Fig. S3 with image from Bräutigam et al., 2011
swimming disrupted, abnormal WT + MO1-glrx2 text only from Bräutigam et al., 2011
trunk vasculature malformed, abnormal y1Tg + MO1-glrx2 Fig. 1 with image from Bräutigam et al., 2013
vasculature development process quality, abnormal y1Tg + MO1-glrx2 Fig. 1 with image from Bräutigam et al., 2013
Phenotype of all Fish created by or utilizing MO1-glrx2
Phenotype Fish Conditions Figures
neuron projection development disrupted, abnormal WT + MO1-glrx2 standard conditions Fig. 3 with image from Bräutigam et al., 2011
secondary motor neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
eye apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
dopaminergic neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
swimming disrupted, abnormal WT + MO1-glrx2 standard conditions text only from Bräutigam et al., 2011
heart contraction process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 1 from Berndt et al., 2014
mechanosensory behavior disrupted, abnormal WT + MO1-glrx2 standard conditions text only from Bräutigam et al., 2011
apoptotic process increased occurrence, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
heart looping process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 2 from Berndt et al., 2014
dorsal aorta blood circulation decreased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 1 from Berndt et al., 2014
hindbrain apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image,  Fig. S3 with image from Bräutigam et al., 2011
central nervous system projection neuron axonogenesis disrupted, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image,  Fig. 3 with image from Bräutigam et al., 2011
central nervous system apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
cell death increased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 5 from Berndt et al., 2014
common cardinal vein blood circulation decreased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 1 from Berndt et al., 2014
spinal cord apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image,  Fig. S3 with image from Bräutigam et al., 2011
central nervous system has fewer parts of type white matter, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
neural crest cell migration involved in heart formation process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 3 from Berndt et al., 2014
central nervous system development disrupted, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image,  Fig. 4 with image from Bräutigam et al., 2011
apoptotic process increased process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 5 from Berndt et al., 2014
forebrain apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2011
neuron axon decreased branchiness, abnormal WT + MO1-glrx2 standard conditions Fig. 3 with image from Bräutigam et al., 2011
neural crest cell migration process quality, abnormal WT + MO1-glrx2 standard conditions Fig. 3 from Berndt et al., 2014
neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
neuron axon decreased length, abnormal WT + MO1-glrx2 standard conditions Fig. 3 with image from Bräutigam et al., 2011
neuron apoptotic, abnormal WT + MO1-glrx2 standard conditions Fig. S3 with image from Bräutigam et al., 2011
glutamatergic neuron decreased amount, abnormal WT + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
neuron decreased amount, abnormal nns1Tg + MO1-glrx2 standard conditions Fig. 2 with image from Bräutigam et al., 2011
glioblast (sensu Vertebrata) cell migration decreased process quality, abnormal vu12Tg + MO1-glrx2 standard conditions Fig. 2 with image from Wilms et al., 2021
trunk vasculature malformed, abnormal y1Tg + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2013
intersegmental vessel malformed, abnormal y1Tg + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2013
vasculature development process quality, abnormal y1Tg + MO1-glrx2 standard conditions Fig. 1 with image from Bräutigam et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.